Analysis of efficacy of different Penicillium fungal species as bio- control agents against Fusarium oxysporum GP Segone orcid.org 0000-0002-5478-3384 Dissertation accepted in fulfilment of the requirements for the degree Master of Science in Crop Science at the North- West University Supervisor: Dr K Ramachela Co-supervisor: Prof CN Ateba Co-supervisor: Dr MC Manganyi Graduation: May 2021 Student number: 23252979 DECLARATION I, Galaletsang Patronella Segone declare that this dissertation with the research title “Analysis of biosafety of different Penicillium species for potential use as biocontrol agents against Fusarium oxysporum” submitted to North-West University is my original work. I have not previously in any form or part submitted to any other university. All sources used in this work have been acknowledged through references. Galaletsang Patronella Segone 14 December 2020 Candidate Signature Date 15-12-2020 Dr Khosi Ramachela Supervisor Signature Date Prof C.N. Ateba 17-12-2020 Co-supervisor Signature Date Dr M.C. Manganyi 15-12-2020 Co-supervisor Signature Date i DEDICATION To my parents; Tidimalo and Solomon Segone The sacrificial care and immense love have carried me this far and made it possible for me to complete this work My grandmother; Gothatamang Keebine And my family The support, prayers and encouragement are much appreciated. “Don’t stop believing” – Journey ii ACKNOWLEDGEMENT My deepest gratitude goes first and foremost to the Almighty God for the wisdom he bestowed upon me, the ability to learn and understand and for the strength and resilience needed to keep holding on and working towards completion of this dissertation. This dissertation is complete today with the invaluable support and assistance from many kind individuals that I would like to extend my heartfelt thanks to. I would like to express my sincere gratefulness and appreciation to the NWU GOOT (Growing Our Own Timber) and the NWU Postgraduate bursary for the financial assistance and a push into furthering this study. To Dr Khosi Ramachela, my sincere gratitude goes mostly to him. For the selfless support, encouragement, guidance, patience and useful advice throughout my M. Sc study, I thank you. I am also thankful to my co-supervisors, Prof C.N. Ateba and Dr M.C. Manganyi for the input and assistance they gave me. To Boitshepo Gopane, your availability and assistance whenever I needed you are greatly appreciated. I would like to thank Dr Khaya Ncama for his advice and willingness to assist and offer transportation to the farm whenever help was needed. I would also like to thank Buhle for her assistance during the writing period and the support and encouragement throughout the study. I am also thankful to Thato and Zuziwe for always lending a helping hand whenever needed. I am thankful to my parents, Solomon and Tidimalo Segone, my sister Tshiamelo Keebine, my grandmother Gothatamang Keebine and my brothers – Itumeleng, Omphile and Ofentse for believing in me and supporting me throughout this journey. Thank you to Mothusi Maruping, your support is highly appreciated. I would not have made it this far if it were not for the support, encouragement and prayers of my family, colleagues and friends, my gratitude knows no bounds. iii Table of Contents DECLARATION ..................................................................................................................................... I DEDICATION ....................................................................................................................................... II ACKNOWLEDGEMENT .................................................................................................................... III LIST OF TABLES ............................................................................................................................. VIII LIST OF FIGURES .............................................................................................................................. IX LIST OF ABBREVIATIONS AND ACRONYMS.............................................................................XII LIST OF PAPERS ............................................................................................................................. XIV ABSTRACT........................................................................................................................................ XV CHAPTER ONE 1.1. GENERAL INTRODUCTION .................................................................................................. 1 1.1.1. Problem statement ............................................................................................................. 3 1.1.2. Justification ....................................................................................................................... 4 1.1.3. Research Objectives .......................................................................................................... 5 1.1.4. Research hypotheses ......................................................................................................... 5 1.2. LITERATURE REVIEW........................................................................................................... 5 1.2.1. Current initiatives on management of F. oxysporum ........................................................ 6 1.2.2. Ecology of Penicillium species ......................................................................................... 7 1.2.3. Identification of Penicillium species ................................................................................. 8 1.2.4. Secondary metabolites production by Penicillium ............................................................ 9 1.2.5. Rhizosphere eco-zones and Plant root microbial interactions ........................................... 9 1.2.5 Biochar as a soil amendment ............................................................................................... 11 1.2.6 Mycorrhizae as a soil amendment ....................................................................................... 11 1.2.7 Influence of biochar and mycorrhizae as soil amendments ................................................. 12 CHAPTER TWO ISOLATION AND IDENTIFICATION OF SOIL-BORNE PENICILLIUM SPP AND OTHER FUNGAL SPECIES IN A SEMI-ARID AGRO-ECOLOGICAL REGION. ....................................... 13 2.1 INTRODUCTION ................................................................................................................... 13 2.1.1 Specific objective(s): ....................................................................................................... 14 2.2 MATERIALS AND METHODS ............................................................................................. 14 2.2.1 Isolation of the fungal species ......................................................................................... 14 2.2.2 Morphological identification of the isolated fungal species ........................................... 14 iv 2.2.3 Molecular identification of the isolated fungal species ................................................... 15 2.2.4 Polymerase chain reaction (PCR) amplification ............................................................. 15 2.2.5 Agarose Gel Analysis ...................................................................................................... 15 2.2.6 ITS sequencing of the extracted fragments ..................................................................... 16 2.2.7 Phylogenetic analysis ...................................................................................................... 16 2.3 RESULTS ................................................................................................................................ 16 2.3.1 Morphological identification of isolated species............................................................. 16 2.3.2 Molecular identification of isolated Penicillium species ................................................ 20 2.3.3 BLAST outputs ............................................................................................................... 21 2.4 DISCUSSION .......................................................................................................................... 21 CHAPTER THREE IN-VITRO ANALYSIS OF THE EFFICACY OF FOUR PENICILLIUM SPP. AND ASPERGILLUS FUMIGATUS ON FUSARIUM OXYSPORUM F.SP. RADICIS LYCOPERSICI (FORL).................................................................................................................................................. 25 3.1. INTRODUCTION ................................................................................................................... 25 3.1.1. Specific objective ............................................................................................................ 26 3.2. MATERIALS AND METHODS ............................................................................................. 26 3.2.1 Experimental description................................................................................................. 26 a. Experimental Design and layout ..................................................................................... 26 b. Data collection and analysis ............................................................................................ 27 3.3 RESULTS ................................................................................................................................ 28 3.3.1 Dual antifungal relationships of selected test isolates against F. oxysporum ................. 28 a. Dual antifungal relationship assessments. ....................................................................... 28 b. Mycelial growth rate assessments ................................................................................... 30 3.3.2 Correlation coefficient..................................................................................................... 33 3.3.3 Inhibition percentage ....................................................................................................... 35 3.4 DISCUSSION .......................................................................................................................... 35 CHAPTER FOUR SCREENING OF PATHOGENICITY OF FOUR PENICILLIUM ISOLATES AND ONE ASPERGILLUS FUMIGATUS SPECIES ON SELECTED VEGETABLES. .................................... 40 4.1 INTRODUCTION ................................................................................................................... 40 4.1.1 Specific objectives: ............................................................................................................. 41 4.2 MATERIALS AND METHODS ............................................................................................. 41 4.2.1 Inoculum preparation and seed inoculation .................................................................... 41 v 4.2.2 Experimental description and design .............................................................................. 42 4.2.3 Data collection ................................................................................................................ 43 4.2.4 Statistical Analysis .......................................................................................................... 43 4.3 RESULTS ................................................................................................................................ 44 4.3.1 Effect of different treatments on seed germination of the selected vegetables ............... 44 4.3.2 Effect of the treatments on the radicle and plumule response ......................................... 46 4.3.3 Effect of the treatments on seedling size and health: Seedling Vigour ........................... 49 4.4 DISCUSSION .......................................................................................................................... 53 CHAPTER FIVE IN- VIVO ANALYSIS OF THE SUPPRESSIVE EFFECT OF P. CONCAVORUGULOSUM2 ON F. OXYSPORUM F.SP. RADICIS LYCOPERSICI (FORL) IN TOMATO (SOLANUM LYCOPERSICUM) SEEDLINGS UNDER DIFFERENT SOIL AMENDMENTS ........................... 58 5.1 INTRODUCTION ................................................................................................................... 58 5.1.1 Specific objectives .......................................................................................................... 59 5.2 MATERIALS AND METHODS ............................................................................................. 59 5.2.1 SOIL COLLECTION AND EXPERIMENTAL SITE DESCRIPTION ..................................................... 59 5.2.2 LABORATORY ANALYSIS DESCRIPTION .................................................................................... 59 a. Soil sterilization and preparation ..................................................................................... 59 b. Soil analysis .................................................................................................................... 59 c. Mycorrhizae and biochar inoculum preparation ............................................................. 60 5.3 EXPERIMENTAL DESCRIPTION AND DESIGN ............................................................................. 60 5.3.1 Experimental description................................................................................................. 60 5.3.2 Data collection ................................................................................................................ 61 5.4 MYCORRHIZAE COLONIZATION ANALYSIS ............................................................................... 62 5.5 STATISTICAL ANALYSIS ........................................................................................................... 62 5.6 RESULTS ................................................................................................................................ 62 5.6.1 Effect of treatments on seedling biomass. ....................................................................... 62 5.6.2 F. oxysporum f.sp. radicis lycopersici (FORL) infection assessment ............................. 64 5.6.3 Mycorrhizal root colonization ......................................................................................... 66 5.7 DISCUSSION .......................................................................................................................... 67 CHAPTER SIX 6.1 GENERAL DISCUSSION AND CONCLUSION ................................................................................ 70 REFERENCES ..................................................................................................................................... 72 APPENDICES ...................................................................................................................................... 83 vi APPENDIX A: BLAST CONSENSUS RESULTS FOR ALL ISOLATED SPECIES (CHAPTER TWO) ................................................................................................................................................ 83 APPENDIX B: ANOVA TABLES FOR CHAPTER THREE.......................................................... 94 APPENDIX C: CHAPTER FIVE EXPERIMENT PICTURES ....................................................... 97 vii List of Tables Table 1.1: Rhizosphere components and their eco-zones* ..................................................... 10 Table 2. 1: Internal Transcribed Spacer Primers sequences that were used for amplification of the ITS regions. ........................................................................................................................ 15 Table 2. 2: Macroscopic and microscopic characteristics of different isolated Penicillium species. ..................................................................................................................................... 19 Table 2. 3: BLAST generated outputs. ................................................................................... 21 Table 2. 4: Names of the Penicillium fungal isolates used in this dissertation ........................ 24 Table 4. 1: ANOVA on the effect of all treatments on S. oleracea germination .................... 44 Table 4. 2: ANOVA on the effect of all treatments on Beta vulgaris seed germination ........ 44 Table 4. 3: Mean comparison and grouping of S. oleracea and B. vulgaris seed germination .................................................................................................................................................. 45 Table 4. 4: ANOVA on the effect of different treatments on S. oleracea plumule response. 47 Table 4. 5: ANOVA showing the effect of all treatments on plumule growth. ...................... 47 Table 4. 6:Table showing germination percentages and vigour index of S. oleracea. ........... 52 Table 4. 7: Table showing germination percentages and vigour index of B. vulgaris. ........... 52 Table 4. 8: Table showing germination percentages and vigour index of S. lycopersicum. ... 53 Table 5. 1: ANOVA showing the effect of treatments on seedling dry biomass. ................... 62 Table 5. 2: Treatment means comparison of seedling dry biomass ........................................ 63 viii List of Figures Figure C.1: 25cm diameter pots containing sown S. lycopersicum seeds in different treatments. .................................................................................................................................................. 97 Figure C.2: Solanum lycopersicum seedlings ......................................................................... 97 Figure C.3: Control seedling and T5 seedlings ...................................................................... 98 Figure C.4: T2 seedlings before and after termination ........................................................... 98 Figure 2. 1: Ladder details that were used in electrophoresis analysis. .................................. 16 Figure 2. 2: (SPP-1 – SPP-5): Varying shapes and colours of different Penicillium cultures. .................................................................................................................................................. 17 Figure 2. 3 (SPP1 – SPP5): Microscopic images of isolated fungal species. SPP1: A- Conidia/spores. SPP2: A- Conidia/spores, B- Hyphae. SPP3: A- Conidia, B- Stipe. SPP4: A- Conidia/spores, B- Fruiting body. SPP5: A- Conidia. ............................................................. 18 Figure 2. 4: ITS1/ITS4 generated DNA bands of the five isolated fungal species. Molecular weight markers (base pairs ladder) are indicated on the left side of the figure. ...................... 20 Figure 3. 1: Experimental setup of the dual anti-fungal analysis: Prior incubation. (A) F. oxysporum discs in PDA growth media (control). (B) P. commune-1 and F. oxysporum discs in PDA growth media. (C) P. commune-2 and F. oxysporum discs in PDA growth media. (D) A. fumigatus and F. oxysporum in PDA growth media. .......................................................... 27 Figure 3.2(a): Fungal growth and interactions between selected fungal species after 7 days: (A): P. concavorugulosum-2 and F. oxysporum, (B): A. fumigatus and F. oxysporum, (C): P. concavorugulosum-1 and F. oxysporum. ................................................................................. 28 Figure 3.3: Mycelial growth comparison of P. concavorugulosum against F. oxysporum f.sp. radicis lycopersici (FORL): Growth rate and interaction collected at a two-day interval for 10 days. ......................................................................................................................................... 30 Figure 3.4: Mycelial growth comparison of A. fumigatus against F. oxysporum f.sp. radicis lycopersici (FORL): Growth rate and interaction collected at two-day interval for 10 days. . 31 Figure 3.5: Mycelial growth comparison of P. concavorugulosum-1: against F. oxysporum f.sp. radicis lycopersici (FORL). Growth rate and interaction collected at a two-day interval for 10 days. .................................................................................................................................... 31 ix Figure 3.6: Mycelial growth comparison of P. commune-1 against F. oxysporum f.sp. radicis lycopersici (FORL). Growth rate and interaction of P. commune1 against F. oxysporum collected at two-day interval for 10 days. ................................................................................ 32 Figure 3.7: Mycelial growth comparison of P. commune-2 against F. oxysporum f.sp. radicis lycopersici (FORL): Growth rate and interaction collected at a two-day interval for 10 days. .................................................................................................................................................. 32 Figure 3.8: Moderate positive relationship between P. commune-1 and F. oxysporum f.sp. radicis lycopersici (FORL). r = 0.785 ..................................................................................... 33 Figure 3.9: Weak positive association between P. concavorugulosum-1 and F. oxysporum f.sp. radicis lycopersici (FORL). r = 0.579 ..................................................................................... 33 Figure 3.10: Very weak positive relationship/association between A. fumigatus and F. oxysporum f.sp. radicis lycopersici (FORL). r = 0.062 ........................................................... 34 Figure 3.11: Very weak negative relationship/association between P. commune-2 and F. oxysporum f.sp. radicis lycopersici (FORL). r = −0.198 ......................................................... 34 Figure 3.12: Weak negative association between P. concavorugulosum2 and F. oxysporum f.sp. radicis lycopersici (FORL). r = −0.429 ........................................................................... 34 Figure 3.13: Inhibition percentages of the four Penicillium isolates and A. fumigatus against F. oxysporum f.sp. radicis lycopersici (FORL). ...................................................................... 35 Figure 4. 1: Seed germination experimental setup. ................................................................ 42 Figure 4.2: S. oleracea seed germination rate over a period of 14 days. ................................ 46 Figure 4.3: B. vulgaris seed germination rate. Germination was collected at the two-days intervals for two weeks. ........................................................................................................... 46 Figure 4.4(a): Two weeks assessment of S. oleracea radicle growth..................................... 48 Figure 4.5(a): B. vulgaris radicle growth assessed at two-day intervals for two weeks. ........ 49 Figure 4. 6: Spinacia oleracea seedlings showing no signs and symptoms of disease occurrence ................................................................................................................................ 50 Figure 4. 7(a): (A) Discoloration symptoms on control treatment. (B) Radicle and plumule necrotic signs on P. commune1 treatment. ............................................................................... 50 Figure 4. 8: S. lycopersicum germinated seedlings. ................................................................ 51 x Figure 5.1: Effect of different soil rhizosphere conditions on S. lycopersicum seedlings dry biomass. T0 = Un-amended rhizosphere + untreated seeds, T1 = Un-amended rhizosphere + untreated seeds + Fusarium inoculation, T2 = Un-amended rhizosphere + P. concavorugulosum2 treated seeds, T3 = P. concavorugulosum2 treated seeds + mycorrhizae amended soil, T4 = P. concavorugulosum2 treated seeds + biochar amended soil, T5 = P. concavorugulosum2 treated seeds +Mycorrhizae + Biochar amended soil (T5). ................... 64 Figure 5. 2: Stem/crown rots, root rots, lesions and leaf necrosis S. lycopersicum seedlings. .................................................................................................................................................. 65 Figure 5. 3: Seedlings grown in the control treatment. ........................................................... 65 Figure 5. 4: Mycorrhizal colonization on T3 and T5 S. lycopersicum seedling roots. (A) Vesicles, (B) Root, (C) Arbuscules.......................................................................................... 66 Figure 5.1: Effect of different soil rhizosphere conditions on S. lycopersicum seedlings dry biomass. T0 = Un-amended rhizosphere + untreated seeds, T1 = Un-amended rhizosphere + untreated seeds + Fusarium inoculation, T2 = Un-amended rhizosphere + P. concavorugulosum2 treated seeds, T3 = P. concavorugulosum2 treated seeds + mycorrhizae amended soil, T4 = P. concavorugulosum2 treated seeds + biochar amended soil, T5 = P. concavorugulosum2 treated seeds +Mycorrhizae + Biochar amended soil (T5). ................... 64 Figure 5. 2: Stem/crown rots, root rots, lesions and leaf necrosis S. lycopersicum seedlings. .................................................................................................................................................. 65 Figure 5. 3: Seedlings grown in the control treatment. ........................................................... 65 Figure 5. 4: Mycorrhizal colonization on T3 and T5 S. lycopersicum seedling roots. (A) Vesicles, (B) Root, (C) Arbuscules.......................................................................................... 66 xi LIST OF ABBREVIATIONS AND ACRONYMS ABI: Applied Biosystems AMF: Arbuscular Mycorrhizal fungi ANOVA: Analysis of variance Aw: Water activity BLAST: Basic Local Alignment Search Tool CCI: Chlorophyll Concentration Index CRD: Completely Randomized Design DNA: Deoxyribose Nucleic Acid ECM: Ectomycorrhizae F. sp.: Formae specialis FOL: F. oxysporum f.sp. lycopersici FORL: F. oxysporum f.sp. radicis lycopersici G.A: Gibberellic Acid ITS: Internal Transcribed Spacer K: Potassium KOH: Potassium Hydroxide Mg: Magnesium N: Nitrogen P: Phosphorus PCR: Polymerase Chain Reaction PDA: Potato Dextrose Agar xii pH: Power of Hydrogen spp: Species VAM: Vesicular-arbuscular mycorrhizae VI: Vigor Index Zn: Zinc xiii LIST OF PAPERS i. Segone. G.P. and Ramachela. K. (2020). ‘In-vitro analysis of suppressive effect of fungal isolates from compost amended soils on commonly occurring soil borne pathogens’, Presented at the DSI-Howard University Women in STEM Conference. Eastern Cape province, South Africa. xiv ABSTRACT The fungal genus Penicillium and many other soil-borne fungi have widely been reported to create soil myco-ecological conditions that influence plant growth. These fungal species have been noted to have the ability to produce and release a diverse range of phytochemicals and exogenous compounds with variable physiological influence on plants, plant growth and other microbes. To positively utilize these unique characteristics of Penicillium species, the study was conceived and designed to investigate the suppressive effects of Penicillium and Aspergillus species against F. oxysporum f.sp. radicis lycopersici (FORL). Different experiments were carried out, i.e. (i) Isolation and identification of soil fungal isolates in the semi-arid agro-ecological region, (ii) Dual anti-fungal assessment of the isolates against F. oxysporum f.sp. radicis lycopersici (FORL), (iii) Analysis of isolates’ phytopathological safety on selected vegetables and (iv) An in-vivo evaluation of the effect of P. concavorugulosum-2 and various rhizosphere conditions against F. oxysporum f.sp. radicis lycopersici (FORL) on S. lycopersicum. This was carried out to determine the myco-suppressiveness of the local and well-adapted Penicillium species and Aspergillus sp. against F. oxysporum f.sp. radicis lycopersici (FORL). Five fungal species were isolated from cultivated soils by use of the serial dilution method. The isolates were morphologically identified to genus level using colony characteristics, i.e. conidia, hyphal form, and conidiophores. Molecular identification was carried out to identify the isolates to species level by use of the PCR method. To investigate the dual anti-fungal association, an in-vitro analysis was carried out by use of mycelial disc method. Safety of these isolates on the commonly grown vegetables viz. Spinacia oleracea, Beta vulgaris and Solanum lycopersicum was assessed by inoculating them with respective fungal isolates. Furthermore, in -vivo evaluation was carried out by assessing the effect of the promising isolate; P. concavorugulosum-2 under five (5) rhizosphere amended conditions. The identification of the fungal soil isolates resulted in the confirmation of the isolate identities to be as follows: Penicillium commune-1 (MK660351.1), Penicillium commune-2 (MK660335.1), Aspergillus fumigatus (MN178806.1), Penicillium concavorugulosum-1 (MK841454.1) and Penicillium concavorugulosum-2 (MK841454.1). Analysis of their dual interaction showed the occurrence of various relationships such as antibiosis, competition and mycoparasitism. High inhibition effect of P. concavorugulosum-2 (67.9%) and A. fumigatus (65.36%) on F. oxysporum f.sp. radicis lycopersici (FORL) was noted. A strong positive linear relationship (r = 0.785) was exhibited between P. commune-1 and F. oxysporum f.sp. radicis lycopersici (FORL). Their effect on the bio-safety study on selected vegetables showed that xv the treatments had statistically significant differences in their effect on the germination, radicle and plumule growth of S. oleracea and B. vulgaris (P<0.05). There was, however, a relatively non-significant positive response on S. lycopersicum. Of interest, is the germination of S. lycopersicum seeds that were treated with P. concavorugulosum-2, P. commune-2 and control which all resulted in 100% germination. In an in-vivo study where the effect of P. concavorugulosum-2 under different rhizosphere conditions was analyzed, there were statistically significant differences in the seedling biomass for the different treatments (P<0.05). The development of P. concavorugulosum-2 as a potential bio-control agent is recommended as it exhibited plant growth stimulatory and protective properties against F. oxysporum. It is recommended that P. concavorugulosum-2 be studied under a situation where it is combined with other promising isolates to explore possible synergistic effects. Keywords: Fusarium oxysporum f.sp. radicis lycopersici (FORL), Penicillium species, Biosafety, Solanum lycopersicum, Mycoparasitism, Antibiosis, Mycorrhizae and Biochar. xvi CHAPTER ONE 1.1. GENERAL INTRODUCTION Crop pests and diseases have persistently caused crop yield losses and are widely considered a major global constraint to crop production (Savary et al., 2019). Oerke and Dehne, (2004) reported that in South Africa, between 1996 and 1998 plant diseases caused crop yield losses of up to 9.9%. Additionally, about 10-16% loss in harvest is still being claimed by pathogens between 2009 and 2011 (Chakraborty and Newton, 2011) . The study also highlighted that yield losses increased to 14.9% when chemical control measures were not applied. Lindenthal et al., (2005) further highlighted that fungi and bacteria resulted in an average of 7% to 15% crop losses in major world crops. Extensive use of chemicals such as insecticides and fungicides in the control of plant pests and diseases has contributed to the high cost of crop and horticultural production (De Bon et al., 2014, Panth et al., 2020). Furthermore, these chemicals have, of late, been widely viewed negatively because of their adverse effects on the environment. A certain number of these agro- chemicals have strongly been associated with carcinogenic effects on humans (Wightwick & Allison, 2007). Although these agro-chemicals have been noted to harm the environment, the high crop yield losses due to pests and diseases has resulted in the extensive global continual use of these chemicals. Fusarium species, among many fungal pathogens, have been reported to have a widespread destructive impact on both field and vegetable crops (Srinivas et al., 2019). Fusarium oxysporum has particularly been noted to be one of the most destructive soil-borne fungal species. This pathogen has a wide range of hosts and has specialized forms (formae specialis (f.sp.)) that cause a variety of diseases (Fravel et al., 2003; Michielse, 2009). There are two forms that result in extensive economic losses in tomatoes i.e. F. oxysporum f.sp. radices-lycopersici (FORL) and F. oxysporum f. sp. lycopersici (FOL) [(Baysal et al., 2009; Debbi et al., 2018; Srinivas et al., 2019)]. FORL attacks the root crown whereas FOL attacks the fine roots and goes up the xylem, causing wilting – Fusarium wilt. These formae specialis forms also include the non-pathogenic F. oxysporum species that have endophytic properties that generate plant defensive mechanism against most soil-borne pathogens (de Lamo & Takken, 2020). The endophytic strain can therefore mediate or reduce the effect of vascular diseases caused by pathogenic strains of F. oxysporum (de Lamo & Takken, 2020). The Fusarium fungal species are generally known to be facultative parasites i.e. in the absence of a 1 host they can live as saprophytes. In the presence of a susceptible host and under suitable environmental conditions they become parasitic (Srivastava et al., 2018). The pathogenic strains can also co-exist with the host without injury but exert harm once the host defence mechanism is compromised, resulting in vascular wilts of seedlings (de Lamo & Takken, 2020). These fungal species can result in high seedling mortality of vegetables such as tomatoes (Solanum lycopersicum), eggplant (Solanum melongena), and peppers (Capsicum annum). These pathogens cause diseases such as vascular wilts, stalk and cob rots, collar rots of seedlings and tuber rots (Pietro et al., 2003; Gordon, 2017; Srivastava et al., 2018). Most susceptible host plants are vegetable crops from the Solanaceae family i.e. S. lycopersicum, S. tuberosum, S. melongena, etc. and the Cucurbitaceae family which include the following: Cucumis sativus, Cucumis melo and Cucurbita. Another susceptible plant family is the Fabaceae family that includes crops such as Pisum sativum, Cicer arietinum and Glycine max. The fungus F. oxysporum attacks its host by gaining entry through the plant roots and grows in the plants’ xylem vessels, eventually blocking the vascular system, preventing transport of water and nutrients to various parts of the plant (Michielse, 2009, Rana et al., 2017, Joshi, 2018). The wilts and mortality of most vegetable seedlings are a result of the destruction of vascular systems. For instance, Naseri and Tabande (2017), highlighted that 108 epidemics of chickpea (Cicer arietinum) affected by Fusarium wilt have been reported worldwide. Fusarium wilt is one of the most prevalent and problematic diseases caused by Fusarium oxysporum and other soil-borne pathogens and is known to drastically impact plant growth and development (Fravel et al., 2003; Srivastava et al., 2018). Effects of Fusarium wilt on S. lycopersicum have been reported to have a direct impact on the economic wellbeing of S. lycopersicum growers because of the high cost of chemicals, fumigants and various control measures that are used to control the diseases (Amini and Sidovich, 2010; Koehler and Shew, 2019). Various soil amendments and management practices have been investigated on their suppressive effect on F. oxysporum. These management practices include the use of fungicides, soil sterilization and fumigation. Their effectiveness has however, been found to be variable between different studies (Oerke and Dehne, 2004; Koehler and Shew, 2019). The use of methyl bromide has for a long time been effective and widely used by farmers. Its use has, however, been discontinued because of the concern on its contribution to methane emission that is destructive to the ozone layer. The other control method that has been commonly employed is the use of resistant cultivars. The use of resistant cultivars has been compromised 2 by the development of new strains of F. oxysporum that can infect and cause seedling mortality in cultivars that are traditionally known to have been resistant to F. oxysporum (Tanyolaç and Akkale, 2010). To develop effective and environmentally safe methods of controlling this pathogen, the use of biological agents has been investigated by various researchers (da Silva et al., 2017, Diblasi et al., 2015, Qualhato et al., 2013). Results of these studies have generated interest among many plant pathologists. One of the interesting results is the study by da Silva et al. (2017) who reported that the colonization of host root rhizosphere by non-pathogenic F. oxysporum as well as P. oxalicum resulted in the reduction of Fusarium wilt diseases. Additionally, Trichoderma, Aspergillus and Penicillium species are some of the most reported species to show promising results as biological control agents against soil-borne pathogens viz. Rhizoctonia solani, Sclerotinia sclerotiorum, Sclerotium rolfsii, F. solani, etc. For instance, Bastakoti et al., (2017) reported that Trichoderma species are more effective as biological control agents against Sclerotium rolfsii than other soil-borne pathogens. Similarly, a study by Urooj et al., (2018) highlighted the interesting suppressive effects of Penicillium species against destructive soil-borne pathogens viz. F. solani, F. oxysporum, R. solani. Toghueo and Boyom, (2020) reported on some species of the Penicillium genus as endophytic and these were P. restrictum and P. asperum. These endophytic Penicillium species were noted to exhibit protection to host plants against various soil-borne pathogens. Toghueo and Boyom (2020) further highlighted the anti-microbial, anti-parasitic, insecticidal and biocontrol properties that these species contain. This, therefore, shows the potential effectiveness of Penicillium species as biocontrol agents against the commonly occurring soil-borne fungal pathogens. This study was therefore undertaken to investigate the following: (i)Isolation, morphological and molecular identification of soil-borne Penicillium species and other soil-borne fungi from various cultivated sites in a semi-arid region. (ii)In- vitro analysis of the effect of identified Penicillium spp. and other fungal isolates against F. oxysporum. (iii)Screening of Penicillium species and other fungal isolates on its phytopathological biosafety on selected vegetable species. (iv)To assess the effect of biochar and mycorrhizae as rhizosphere amendments for enhancement of Penicillium spp suppressiveness on F. oxysporum in tomato seedlings. 1.1.1. Problem statement The excessive use of fungicides, soil fumigants and other agro-chemicals results in adverse effects on the environment. This occurs because of their residual persistence in the soil which alters soil biochemical and physical properties resulting in polluted terrestrial ecosystems and 3 waterways (Larena et al., 2003; Wightwick & Allinson, 2007). For example, Eijsackers et al. (2005) and Wightwick et al. ( 2008) highlighted the concerns over the excessive use of copper- based fungicides which resulted in the accumulation of copper in the soil. These high levels of copper have been reported to negatively affect beneficial soil microbial populations such as mycorrhizae and saprophytes fungi that play an important ecological role in the soil. In an effort to find an ecologically safe technology that can be employed to control soil-borne pathogens, the use of bio-control agents and various soil sterilization techniques have been investigated. For example, biological agents which include among others; fungal microorganisms such as Trichoderma species, and bacterium species like Pseudomonas and Bacillus subtilis have been explored (Larena et al., 2003). However, Trichoderma species are more effective in moist and slightly acidic soils. They have been noted to be less effective when used in soils that are not amended with compost or farmyard manure (Kumar et al., 2014; Hamed et al., 2015; Konappa et al., 2018). The species are also not highly persistent in the soil. The poor persistence in the soil results in the need for repeated application and therefore causing excessive usage. This makes its use rather expensive and not easily accessible to smallholder farmers who are generally not financially well-resourced. However, there is on- going research on Trichoderma that is looking at the development of Trichoderma formulations with longer field persistence and suitability for dry weather conditions (Kumar et al., 2014). In addition to the studies on Trichoderma, other efforts are exploring other soil-borne fungi isolates that can be used as soil bio-control agents for the management and control of the commonly occurring soil-borne plant pathogens. 1.1.2. Justification Various studies on the use of various fungal species such as Penicillium and certain bacterial species as a biological control of soil-borne pathogens agent have shown interesting results. This study, therefore, seeks to identify Penicillium species and any other fungal isolates with myco-suppressive effects that are endemic to the semi-arid region and therefore well adapted to the conditions. These well-adapted fungal biotypes can be used as a bio-control agent in vegetable seedling nurseries against F. oxysporum and other problematic soil-borne fungal pathogens. It is the goal of this study to develop an ecologically stable low-cost bio-control formulation that is affordable for smallholder farmers in the semi-arid regions. 4 1.1.3. Research Objectives Main objective: To investigate the suppressive effect of Penicillium species and other soil-borne fungi on Fusarium oxysporum f.sp. radicis lycopersici (FORL) in tomato seedlings. Specific objectives: (i) Isolation, morphological and molecular identification of soil-borne Penicillium species and other soil-borne fungi from various cultivated sites in a semi-arid region. (ii) To carry out In- vitro analysis of the effect of identified Penicillium spp. and other fungal isolates against F. oxysporum. (iii)To carry out screening of Penicillium species and other fungal isolates on its phytopathological biosafety on selected vegetable species. (iv) To assess the effect of biochar and mycorrhizae as rhizosphere amendments for enhancement of Penicillium spp suppressiveness on F. oxysporum in tomato seedlings. 1.1.4. Research hypotheses (i) Penicillium species and other soil-borne fungal isolates’ effectiveness against F. oxysporum will vary. The variation will depend on the presence of anti-fungal (exogenous compounds) properties by the species. (ii) Different Penicillium species and other soil-borne fungal isolates will enhance seed germination of the three selected vegetables by providing phytochemicals/growth- promoting hormones that improve seed germination. (iii) Different rhizosphere amendments will enhance Penicillium suppressiveness against F. oxysporum by improving soil properties; soil fertility, soil structure and soil water holding capacity. 1.2. LITERATURE REVIEW The extensive and excessive use of agrochemical compounds such as fungicides to control soil- borne pathogens has become a global concern. These agrochemicals, among many other concerns are toxic, unstable and have been noted to cause environmental pollution (Jayaraj et al., 2016). 5 The use of copper-based fungicides and other compounds as soil applications for control of soil-borne pathogens has been reported to decrease growth, survival, as well as behavioural aspects of a wide range of beneficial soil microorganisms (Eijsackers et al., 2005). Repetitive uses of fungicides result in residual persistence and fungicidal drift into the air and waterways, which pose a health hazard to both human health as well as aquatic organisms’ survival (Wightwick et al., 2010). This has led agricultural scientists to explore initiatives that can lead to the development of environmentally safe methods that can be used to manage and control the problematic soil-borne pathogens. The ecologically safe control methods that have been investigated include the use of organic amendments such as green manure, animal manure, compost, and peats. These organic amendments have been noted to decrease the occurrence and severity of various soil-borne disease, albeit to different levels (Magid et al., 2001). Although some reports indicated the effectiveness of organic amendments as suppressants of various soil-borne pathogens, Bonanomi et al. (2010) highlighted that these organic amendments may increase the occurrence and severity of certain species of pathogens. Extensive research on various organic amendments has been carried out, however, no soil amendment management technology for the control of soil-borne pathogens has been successfully developed. It has however, been established that organic amendments aid in the reduction of chemical damage and toxicity. They have also been noted to play an important ecological role in soil health. They serve as a food source for antagonistic microorganisms that are found in the soil and these aid in the reduction of seedling attack by certain soil-borne pathogens. Fungal pathogens such as Fusarium oxysporum are known to cause detrimental effects on plant growth and development of different crops and vegetables. A number of management strategies have then been initiated and used to mitigate the impact and pathogenicity of F. oxysporum. These include the use of different microorganisms that have shown effectiveness against pathogenic fungal species, for example, the use of Trichoderma species in plant production to suppress growth of pathogenic microbes while improving plant growth and productivity (Bastakoti et al., 2017). 1.2.1. Current initiatives on management of F. oxysporum Fusarium oxysporum f.sp. radicis lycopersici is commonly known as Fusarium crown rot and has been reported to cause severe economic loses in both field and greenhouse productions (Manzo et al., 2016). The pathogen has been ranked 5th among the top 10 fungal pathogens 6 (Husaini et al., 2018) is reported to be a major challenge in agricultural production world-wide (McGovern, 2015). Studies conducted to understand this pathogen resulted in a variety of integrated strategies such as chemical, host-resistance, biological and physical control (Szczechura et al., 2013, McGovern, 2015, Manzo et al., 2016, Zhao et al., 2017, Srinivas et al., 2019). A study by (Yuce et al., 2010) analysed the effectiveness of the integration of solarization combined with hydrogen peroxide and benzoic acid on the pathogen and concluded that the combination could be an effective environmentally friendly chemical that can suppress the impact of FORL and FOL. Furthermore, a study on biological control analysis of antifungal effects of medicinal plants viz. Zygophyllum album, Euphorbia guyoniana, Atriplex halimus etc. on FORL was conducted by (Wassima, 2017). The study found a 75,25% inhibition rate and effect of Z. album on FORL after 8 days and concluded that an aqueous extract of the plant showed promising results against the pathogen. A number of biological control agents by use of fungal microorganisms such as Glomus intraradices and Trichoderma harzianum have shown suppressiveness against FORL and are considered natural enemies or antagonists of the pathogen (Akköprü and Demir, 2005, Martínez-Medina et al., 2010, Castillo et al., 2019). 1.2.2. Ecology of Penicillium species Penicillium is an omnipresent fungal genus that is prevalent in soil, food, feed, and can be classified as an opportunistic fungus (Perrone and Susca, 2017; Park et al., 2019). These fungal species are generally considered facultative i.e. can survive as both saprophytes and parasites. Most species exhibit optimal growth at moderate to low temperatures and can grow at water activities (aw) below 0.9 (Pitt, 2002). Water activity may be defined as the measurement of the energy status of water in a food, soil and plant systems (Alkorta et al., 2017; Lenovich, 2017). Penicillium species vary in their ecological effects as most may result in food and feed deterioration whereas certain species can produce metabolites while a few are endophytes, parasitic or saprophytes (Pitt et al., 2000; Pitt, 2002; Pitt and Hocking, 2009). Growth of Penicillium species or any other fungal growth and production of metabolites are influenced by various factors such as host characteristics and climatic factors. Pointing out a single factor would therefore be scientifical inappropriate as they generally function collectively (Hyde et al., 2019). These factors can be categorized as climatic factors, competitive actions, plant properties, and other environmental factors such as pH, water activity (aw), and oxygen content (Popovski and Celar, 2013). Temperature and water activity (aw) are the most important set of conditions influencing the growth and metabolite production 7 of fungi such as Penicillium and Fusarium species (Abellana et al., 2001). The influence and interactions between this set of conditions on the growth of three Penicillium species – P. aurantiogriseum, P. chrysogenum, and P. corylophilum, and metabolites/mycotoxin production were studied by Abellana et al., (2001) and Sanchis et al., (2004). The researchers concluded that growth rates showed a strong dependence on water activity and temperature. The minimum water activity values for growth of these species were 0.85 – 0.9. The conclusion was, however drawn and established that an increase in water activity results in an increase in temperature since a water activity of 0.85 - 0.90 showed the optimum growth of Penicillium species between the temperature of 20 ℃ and 25 ℃. Studies by Frisvad et al., (2006, 2007 and Frisvad et al., (2007) showed that various Penicillium species produce metabolites and the importance of these compounds depends on the ecology and biology of the species. Frisvad et al., (2006) highlighted that for the influence on the production of the metabolites to be evident, the species should be grown in a suitable host plant or food and the temperature should favour germination and water activities should be optimal. Metabolites production by Penicillium species is however complex as the formation of the compounds differs from species to species. Most species produce a single toxin whereas some produce more than one toxin (Pitt et al., 2006). For example, Penicillium expansum and Penicillium crustosum produce two toxins whereas other species such as Penicillium islandicum and Penicillium simplicissumum produce four toxins (Pitt et al., 2000, 2006; Pitt, 2002). 1.2.3. Identification of Penicillium species Various laboratory techniques are used in the identification of fungal micro-organism. The traditional approach of morphological evaluations, as well as different methods of molecular identification, are some of the approaches that are often used (Bandh et al., 2011; Bechem et al., 2017). Similar approaches are also applied in Penicillium fungal species identification whereby conventional traditional and microscopic morphological identification and molecular analysis are used. These methods include evaluation of the fungal colony for characteristic features such as colour, shape/form, size, spores/conidia, and fruiting bodies/conidiophores (Kim et al., 2013; Alsohaili and Bani-Hasan, 2018). Molecular analysis methods, on the other hand, include subjecting Penicillium mycelium to DNA extraction procedures, PCR, gel electrophoresis, ITS and phylogenetic analysis for species determination (Houbraken et al., 2011; Peterson, 2012; Demirel et al., 2013; Visagie et al., 2014; Bechem et al., 2017; Koffi et al., 2019; Sawant et al., 2019). Among the conventional microbial identification methods, 8 microscopy identification is still mostly used as it is less expensive. However, various studies have proven that the use of molecular analysis is more accurate and recommended for Penicillium species. This is because the Penicillium fungal species belong to a large genus that shows little to no variation in media cultures and in morphology which often leads to inaccuracies in morphological identification procedure (Visagie et al., 2014). 1.2.4. Secondary metabolites production by Penicillium Metabolite production is the synthesis of secondary metabolic substances by some fungal microorganisms which they use to defend themselves when exposed to unfavourable conditions (Ismaiel and Papenbrock, 2015; Cinar and Onbaşı, 2019). Various fungal species such as Penicillium, Aspergillus and Fusarium genera are amongst the fungal microorganisms that produce harmful toxic biochemicals (Desjardins and Proctor, 2007). Various studies have also highlighted the effects of fungal metabolites on agricultural production, food production and human health (Zain, 2011; Mokogwu et al., 2017; Cinar and Onbaşı, 2019; Nguyen et al., 2019). The Penicillium genus has over 300 recorded species and they are recognised as multifunctional due to their production of diverse secondary metabolites (Perrone and Susca, 2017). Biochemical compounds such as ochratoxin A & B, aflatoxin B1, citrinin, acanin, pestalotin, 7-hydroxypestalotin and questiomycin A were regarded and reported as mycotoxins by Bräse et al., (2009). They were further reported to be Penicillium produced (Olsen et al., 2019). Metabolite effects are reported on seed quality reduction, negative effect on germination, root growth and seedling vigour (Ismaiel and Papenbrock, 2015; Perrone and Susca, 2017). Despite the negative effects exerted on plants and plant growth by certain species in this genus, they can, however, be investigated for their potential use as biocontrol agents i.e. their use in the reduction of soil-borne pathogens. 1.2.5. Rhizosphere eco-zones and Plant root microbial interactions The rhizosphere is a closely compacted area of the soil that surrounds plant roots and is influenced by plant root exudates and soil factors surrounding the roots. The micro-ecology of the region is such that plant roots compete with the invading soil-borne microorganisms such as fungi, bacteria and various insects for space, nutrients, water, and minerals (Giri et al., 2003). Similarly, the root rhizosphere is influenced by secretion of a diverse mixture of compounds or chemicals by the roots. Sugiyama and Yazaki, (2014) highlighted that the compounds 9 secreted by plant roots serve an important role as chemical attractants or repellents to various soil microorganisms in the rhizosphere. These exudates assist in the classification of different zones and components that play a significant role in determining characteristics of a specific rhizosphere component (Bazin et al., 1990; York et al., 2016)., [ Table 1]. Table 1.1: Rhizosphere components and their eco-zones* Component Size Definition Rhizosphere ~cm Soil influenced by roots Rhizoplane 1 mm Root epidermis, mucigel, and adhering soil Rhizosheath 1 mm Soil adhered by root hairs and mucilage P depletion zone 3 mm Concentration gradient of P in soil solution due to uptake N depletion zone 2 cm Concentration gradient of N in soil solution due to uptake Accumulation zone 1 mm Calcium from mass flow but not adsorbed Soil structure 1 cm Changes in soil porosity, soil architecture modification modification Oxygen depletion 3 mm Oxygen uptake due to root and microbial respiration CO2 Accumulation 3 mm Respired carbon dioxide from roots and microbes Exudation zone 2 mm Sugars, mucilage, acids, allelochemicals released by roots Microbe µm– Fungal mycelia transcend six orders of magnitude in m scale *Source: York et al., (2016) There are various interactions between microorganisms, plant roots, and the soil, that alter the soil chemical and physical properties. These interactions, in turn determine the microbial population in the rhizosphere (Huang et al., 2014). These interactions can be beneficial to the soil environment as well as the plants (Nadeem et al., 2014). They may be classified as positive as well as negative interactions and are mediated by plant roots. Plants are influenced positively through mechanisms such as nitrogen fixation, increased biotic and abiotic stress tolerance by the presence of endophytic microorganisms, and mycorrhizal association (Bais et al., 2006; Weir et al., 2010). Various studies on rhizosphere influences have highlighted that microorganisms are attracted to compounds produced through root exudation (Bais et al., 2006; Nadeem et al., 2014), thus signalling and initiating colonization by various beneficial as well as non-beneficial microorganisms. Microorganisms present in the rhizosphere include bacteria, fungi, actinomycetes, and protozoa. However, fungi and bacteria are generally the most abundant (Nadeem et al., 2014). 10 There is a symbiotic relationship between mycorrhizal fungi and plant roots which aids in the increase of the plant root surface area, enabling the plant to absorb water and nutrients such as phosphorus and nitrogen more efficiently (Sugiyama et al., 2014). There are two types of mycorrhizae involved in the symbiotic relationship, the ectomycorrhizae (ECM) and the arbuscular mycorrhizal fungi - AMF (Nadeem et al., 2014). Arbuscular mycorrhizae are the most abundant in agricultural soils and they assist the ecosystem through their role in nutrient cycling (Christie et al., 2004). A study by Brito et al. (2013) established enhanced growth and productivity of various vegetable crops that were associated with root colonization by mycorrhizal fungi. Arbuscular mycorrhizal fungi can increase the availability and supply of slowly diffusing ions and can provide macro- and micro-nutrients such as N, K, Mg, and Zn to the plants particularly in soils where the nutrients are available in less soluble forms (Smith et al., 2008; Nadeem et al., 2014). 1.2.5 Biochar as a soil amendment Biochar may be defined as carbonized biomass produced under low oxygen (Yao et al., 2017) and it may be used as a soil amendment to enhance agricultural and environmental value. The carbonized biomass can also assist in retaining water and nutrients in the soil thus improving water uptake by plants. The use of biochar as a soil amendment is on the increase among farmers because of its ability to improve soil quality and crop productivity (Zheng et al., 2010). Biochar can adsorb and immobilize heavy metal ions found in contaminated soils (Hossain et al., 2010; Hayyat et al., 2016; Zhou et al., 2017; Wang et al., 2019). Efficiency and effectiveness of biochar as a soil amendment depend on the plant type used, soil type, biochar production temperature and the rate of application (Rizwan et al., 2016). Application rate also influences the availability of microbes in the soil as biochar modifies the soil physical and biochemical properties and facilitates soil fungi reproduction and spore germination including fungi such as arbuscular mycorrhizae (Zhang et al., 2013; Hammer et al., 2015). 1.2.6 Mycorrhizae as a soil amendment Mycorrhizal fungi have been termed and considered to be natural bio-fertilizers that aid in the enhancement of plant water and nutrients uptake as well as protection against pathogenic soil microorganisms (Berruti et al., 2016). Numerous studies with various aims and objectives have 11 been undertaken by several researchers with the aim of analysing effects that mycorrhizal fungi have on plant growth, nutrient uptake and mechanisms involved in plant root colonisation. For example, Watts-Williams et al.( 2017) analysed benefits of AMF under both zinc (Zn) deficiency and toxic conditions to determine the type of transporter gene involved in root colonisation under various zinc stress conditions. Other studies by Amballa and Bhumi (2016) and Igiehon et al. (2017) explored different influences and benefits of AMF interactions with other microorganisms and abiotic soil factors on plant growth, health and nutrition. These studies generally concluded that mycorrhizal fungi interactions with rhizosphere organisms and influence plant health, soil fertility and crop productivity positively. 1.2.7 Influence of biochar and mycorrhizae as soil amendments Symbiotic influence of mycorrhizal fungi on plants and plant roots has been commended for various improvements in plant growth and development (Paymaneh et al., 2018). Biochar on the other hand has been advocated for its numerous positive effects on soil physical and biochemical properties as well as plant development. These positive influences in plant growth and soil improvement have resulted in several researchers investigating the effect of a combination of mycorrhizae and biochar as a soil amendment. A study by Hammer et al., (2015) showed that combined application of biochar and arbuscular mycorrhizae had a synergistic effect on nutrient cycling. This blended soil amendment also influenced the sequestration of heavy metals and thereby reducing their negative effect on microbial activity. Zhang et al., (2013) also highlighted that there were studies that reported and justified the use of biochar together with arbuscular mycorrhizal fungi. It has however remained unclear whether the combination can synergistically increase availability of beneficial microbes and decrease heavy metal uptake by plants. Therefore, mechanical and physiological protection induced by mycorrhizae and the ability to sequester trace elements in combination with biochar as a source of carbon for the mycorrhizae are investigated as soil amendments in this study through an in-vivo experiment. 12 CHAPTER TWO Isolation and identification of soil-borne Penicillium spp and other fungal species in a semi-arid agro-ecological region. 2.1 INTRODUCTION Penicillium species are a widespread group of facultative fungi which are found in various habitats such as soil, air and decaying plant matter (Pitt and Hocking, 2009; Visagie et al., 2014). Various studies have reported the genus to contain several species which possess different roles in agriculture and human health. For example, species such as Penicillium cyclopium and Penicillium citrinum have been reported to be contaminants in corn, soybean, and dried beans (Munkvold et al., 2019). Whereas Penicillium expansum and many other Penicillium species have been reported to cause post-harvest losses in pome fruits and apples (Pitt and Hocking, 2009; Wu et al., 2019). Many Penicillium species produce extracellular enzymes such as cellulolytic enzymes, polysaccharases and pectic enzymes that aid in the breakdown of organic materials and use in antibiotic production, cell degeneration, as well as food production (Yoon et al., 2007; Rabha and Jha, 2018). Production of these enzymes and phytohormones by Penicillium fungal species that influence plant physiological processes was also reported by Sanders, (2011) as well as Chanclud and Morel, (2016). Tiwari et al. (2011) also highlighted Penicillium species as some of many fungal microorganisms that possess multifunctional properties that enable them for use in various agro-industries, biological, medicinal, and commercial uses. Therefore, commercial and industrial use of the different fungal species including Penicillium species require accurate identification. Identification of fungal microorganisms is based on analyzing morphological features of the mycelial colony and their respective spores. Features such as hyphal type and the presence or absence of special characteristics such as conidia and conidiophores etc. are used in determining the genera of most fungal microorganisms (Bandh et al., 2011). The use of morphological features is however not very accurate and has on many occasions lead to inaccurate identification. This has led to the development and utilization of molecular identification techniques. This technology uses polymerase chain reaction (PCR). Fungal microorganisms are mostly analyzed using the PCR method to determine the ITS region so that there could be accurate differentiation of species amongst the genus (Johnston, 2011). 13 The objective of this study was therefore to carry out identification and differentiation of fungal isolates from cultivated soils using morphological characteristics and molecular analysis using PCR techniques. 2.1.1 Specific objective(s): i. To isolate and morphologically identify Penicillium species using the serial dilution technique and microscopic examination ii. To molecularly identify the isolated fungal species using PCR methodology. 2.2 MATERIALS AND METHODS 2.2.1 Isolation of the fungal species Four soil samples were collected from different sites at the North-West University Mafikeng agricultural farm. These sites had previously been subjected to different agronomic practices such as minimum soil tillage, weed control, fertilizer management and controlled irrigation. Soil sub-sample suspensions were prepared by mixing 100g of each of the four sampled soils with 700ml of distilled water, respectively. Single spore isolation of fungal species growing in the respective soil samples was made by doing serial dilutions (Sarker et al., 2006). One (1) ml of the sixth test tube of the serial dilution was pipetted onto the Petri dishes containing potato dextrose agar (PDA) growth media and incubated at 25±1℃ for 48 hours. Re-isolation from colonies was carried out after 48hours of incubation. Agar plug were cut by use of dissecting pins and cultured into PDA media. 2.2.2 Morphological identification of the isolated fungal species Morphological identification, i.e. macroscopic and microscopic was carried out by analysing colony colour and texture as well as microscopic characteristics such as type of mycelial structure (septa) and fungal spores (shape, colour, and fruiting body). ZEISS ZEN 2016 software compound microscope at 400x magnification. 14 2.2.3 Molecular identification of the isolated fungal species Genomic DNA was extracted by aseptically scraping mycelia of the different isolates from the respective PDA Petri-plates. Mycelial DNA was extracted using the Quick-DNATM fungal/bacterial Miniprep Kit (Zymo Research, Catalogue No. D6005) (White et al., 1990). 2.2.4 Polymerase chain reaction (PCR) amplification Amplification of the target genes was carried out by use of OneTaq® Quick-load® 2×Master Mix (NEB, Catalogue No. M0486) with primers presented in Table 1. Each Eppendorf tube comprised of 10µl of NEB OneTaq 2X MasterMix with Standard Buffer (Catalogue No. M0482S), 1µl of genomic DNA (10-30ng/μl), 1µl forward primer (10μM), 1µl reverse primer (10μM), and 7µl nuclease-free water (Catalogue No. E476). Amplification cycles had an initial denaturation at 94 ºC for 10 mins, 35 cycles of denaturation at 94 ºC for 30 seconds, annealing at 50 ℃, elongation at 68 ºC for 1 minute and final elongation at 72 ºC for 10 mins. The PCR amplicons were stored at 4 ºC until electrophoresis. Table 2. 1: Internal Transcribed Spacer Primers sequences that were used for amplification of the ITS regions. Name of Target Sequence (5’ to 3’) Cycling conditions primer ITS 1 Small TCCGTAGGTGAACCTTGCGG 94℃ 𝑓𝑜𝑟 30 𝑠𝑒𝑐 } 35 𝑐𝑦𝑐𝑙𝑒𝑠 50℃ 𝑓𝑜𝑟 30 𝑠𝑒𝑐 Sub-unit ITS 4 Large TCCTCCGCTTATTGATATGC 68℃ 𝑓𝑜𝑟 1 𝑚𝑖𝑛 } 35 𝑐𝑦𝑐𝑙𝑒𝑠 68℃ 𝑓𝑜𝑟 10 𝑚𝑖𝑛 Sub-unit 2.2.5 Agarose Gel Analysis The integrity of the PCR amplicons was visualized on a 1% agarose gel (CSL-AG500, Cleaver Scientific Ltd) stained with EZ-vision® Bluelight DNA Dye. The gel ladder used for analysis is shown in Figure 2.1. 15 Figure 2. 1: Ladder details that were used in electrophoresis analysis. 2.2.6 ITS sequencing of the extracted fragments The extracted fragments were sequenced in the forward and reverse direction (Nimagen, BrilliantDyeTM Terminator Cycle Sequencing Kit v3.1, BRD3-100/1000) and were purified using (Zymo Research, ZR-96 DNA Sequencing clean-up KitTM, Catalogue No. D4050). 2.2.7 Phylogenetic analysis The purified fragments were analysed on the ABI 3500xl Genetic analyser (Applied Biosystems, ThermoFisher Scientific) for each reaction and every sample. CLC Bio Main Workbench v7.6 was used to analyse the ab1 files generated by the ABI 3500xl Genetic analyser and the results were obtained by conducting a BLAST search (NCBI) (Stephen et al., 1997). 2.3 RESULTS 2.3.1 Morphological identification of isolated species Morphological characteristics may be defined as a variation in shape, size, and structure of an organism (Wang et al., 2015). This variation assists in the classification of organisms to their respective genera. Morphological identification of the fungal isolated species was carried out based on such characteristics. Figure 2.2 shows different macroscopic features of different isolates i.e. colony colour, form and shapes. Figures 2.2 and 2.3 show macroscopic and microscopic features of the isolated fungal isolates. 16 SPP-1 SPP-2 SPP-3 SPP-4 SPP-5 Figure 2. 2: (SPP-1 – SPP-5): Varying shapes and colours of different Penicillium cultures. 17 Microscopic morphological characteristics of spores and fruiting bodies of different isolated fungal species are shown in Fig. 2.3. Special structures such as conidiophores, hyphae and conidia were noted from the various species. A A B SPP-1 SPP-2 AA BB SPP-3 AA A BB SPP-4 SPP-5 Figure 2. 3 (SPP1 – SPP5): Microscopic images of isolated fungal species. SPP1: A- Conidia/spores. SPP2: A- Conidia/spores, B- Hyphae. SPP3: A- Conidia, B- Stipe. SPP4: A- Conidia/spores, B- Fruiting body. SPP5: A- Conidia. 18 Fungal features of isolate SPP-1 showed conidia that had a light green colour at the centre and had a round shape. Isolate SPP-2 showed septate hyphae that were surrounded by round conidia, and isolate SPP-3 produced brush-like conidiophore, round clustered conidia with a light green colour at the centre. Isolate SPP-4 produced green coloured conidia surrounding a conidiophore and the conidia were spheroid in shape. Isolate SPP-5 produced oval-shaped conidia with a green tinge. The conidia appeared in abundance and were clustered (Fig 2.3). Different macroscopic and microscopic features are presented in Table 2.2. Table 2. 2: Macroscopic and microscopic characteristics of different isolated Penicillium species. Sample Probable ID Growth Macroscopic Microscopic characteristics number rate characteristics Nature of Presence of hyphae special structure Colony colour Top Bottom SPP-1 Penicillium Moderate Dark green White Smooth Conidia SPP-2 Penicillium Slow Fern green Cream Septate and Hyphae with smooth Conidia yellow spots SPP-3 Penicillium Rapid Forest green Cream Apical and Conidia white septate Conidiophore SPP-4 Penicillium Moderate Olive green Cream Smooth Circular white and septate conidia SPP-5 Penicillium Rapid Moss green Cream Septate Spheroidal with conidia orange spots Mycelial growth assessment was carried out daily for seven (7) days by use of vanier calipers. The fungal isolate SPP-1 colony formed dark green separate concentric rings and with white colour at the back and base. Based on these characteristics the isolate was identified to be Penicillium spp-1. Isolate SPP-2 grew slowly with numerous concentric rings that were dark 19 green with white mycelial edges and a cream back view with yellow spots and was identified as Penicillium spp-2. Isolate SPP-3 on the other hand was a rapid grower with forest green powdery mycelia that covered the whole media and had cream back view and it was identified as Penicillium spp-3. Isolate SPP-4 was olive green with a moderate growth rate and cottony mycelial form and a cream white back view, based on these characteristics it was identified as Penicillium spp-4. Isolate SPP-5 had a pale green front view and a cream back view that had orange spots and formed powdery mycelia that were shaped like small granular rings that filled the entire PDA media, it was therefore identified as Penicillium spp-5. 2.3.2 Molecular identification of isolated Penicillium species On completion of morphological identification, these samples were further subjected to molecular analysis to determine the accuracy of the morphological identification and to also identify the respective isolates to species level. The respective fungal isolates were processed and subjected to PCR analysis to generate DNA fragments. Fig.2.4 shows a photographic image of an agarose gel indicating DNA fragments generated by the ITS1/ITS4 PCR. 1 2 3 4 5 Figure 2. 4: ITS1/ITS4 generated DNA bands of the five isolated fungal species. Molecular weight markers (base pairs ladder) are indicated on the left side of the figure. Key: 1 to 5 indicates the PCR reactions of the isolated fungal species. 20 2.3.3 BLAST outputs The generated DNA sequences of the respective fungal isolates were queried by assessing their similarity against the biological sequence within the NCBI database, and the following outputs were obtained. Table 2. 3: BLAST generated outputs. Isolate 1 Isolate 2 Isolate 3 Isolate 4 Isolate 5 Name of Isolate SPP-1 Isolate SPP-2 Isolate SPP-3 Isolate SPP-4 Isolate SPP-5 sample Request ID STGXS6RS0 STGZW2FT0 SW337SHV0 T38PRS7401 T38R4RF801 15 15 14 5 5 Predicted Penicillium Penicillium Aspergillus Penicillium Penicillium Organism commune commune fumigatus concavorugul concavorugul osum osum GenBank MK660351.1 MK660335.1 MN178806.1 MK841454.1 MK841454.1 Accession number The BLAST nucleotide sequencing results and the use of the GENBANK (www.ncbi.nlm.nih.gov) gave various Penicillium species and one Aspergillus species and these are shown in Table 2.3. Isolate SPP-1 and SPP-2 were identified as Penicillium commune, Isolates SPP-4 and SPP-5 were both identified as Penicillium concavorugulosum, while isolate SPP-3 was identified as Aspergillus fumigatus, which was initially morphologically identified as a Penicillium species. 2.4 DISCUSSION The results indicate that although the identification of Penicillium fungal isolates by analyzing morphological characteristics had limited accuracy, it is relatively useful. Differences in the mycelial colour were noted on all Penicillium species (Figure 2.2). These could probably be 21 explained by the inherent genetic differences and/or environmental influences such as temperature and pH of the soil where they were isolated from. Influence of environmental factors such as temperature and pH on mycelial pigmentation of Penicillium species were previously noted and reported by various researchers (Mendez et al., 2011; Afshari et al., 2015). For example, Mendez et al., (2011) reported that T. purpurogenum (formerly known as P. purpurogenum) produces colourants in both solid and liquid growth media. They further highlighted that the colour differences occurred because of the effect of varying growth temperatures. All five species were morphologically identified to the genus level as Penicillium fungi, but one isolate was later identified by using molecular analysis technique to belong to genus Aspergillus. It should be noted that morphological differences of fungal species can be influenced by environmental factors as reported by Mendez et al. (2011) along with Afshari et al. (2015). Macroscopic characteristics i.e. colony colour/pigmentation and mycelial form of these species were noted to be different (Figure 2.3). This could have been interpreted to mean that the species were of different strains or that variations in environmental conditions such as temperature, moisture, pH and light from the different soils could have caused the difference in their morphological features. A study by Shrestha et al., (2006) reported an effect of varying light conditions, temperature, pH and moisture have on pigmentation, texture, and mycelial density of fungal cultures. It can therefore be deduced that the differences in morphological features (colour) of the fungal isolates SPP-1, SPP-2, SPP-3, SPP-4 and SPP5 could have resulted from both genetic and environmental factor influences. Confirmation through molecular analysis was therefore needed for the morphologically identified Penicillium species. Penicillium species are relatively difficult to differentiate to species level by use of morphological characteristics. This is because of the close similarities in microscopic features among species of this genus (Cardoso et al., 2007). This, therefore, necessitates the need to use molecular identification techniques for identification at the species level. In this study, the use of molecular identification addressed the morphological misidentification of Aspergillus species as a Penicillium species. Molecular identification of these fungal species relied on analysis of DNA band sizes and DNA nucleotide sequences of the test samples. DNA fragments generated on a 1% agarose gel were of similar size at 1.0kb for all the isolates. According to various researchers, agarose electrophoresis is the most practical and effective method used for separation of DNA molecules based on their sizes (Voytas, 2001; Raja et al., 22 2017; Green and Sambrook, 2019). Isolate SPP-1 generated the faintest and low DNA band while isolate SPP-4 and SPP-5 generated high and thicker matching DNA bands at the same size. The SPP-3 fungal isolate, although initially morphologically identified as Penicillium was however identified through molecular analysis as A. fumigatus. This highlighted the limitation of the morphological identification procedure. Furthermore, the limitation of this procedure to identify these isolates to the species level highlights a grey area that limits a detailed understanding of the individual Penicillium species’ fungal biology and ecological interactions. The determination of the inaccuracy of morphological identification of fungal isolates is an important finding. This is particularly critical when there is a need to separate Penicillium species that have the potential to be developed as ecologically stable biocontrol agents from those that harm both human beings and the environment. As earlier indicated in the above paragraph, isolate SPP-3 which had been morphologically identified as Penicillium species was later molecularly identified as A. fumigatus. Similar morphologically microscopic misidentification of Aspergillus and Penicillium species were also reported by Tsang et al., (2018). He reported close similarities of Penicillium and Aspergillus respective spore shapes, textures, colours, and sizes (Fig 2.3). Although morphologically identified to be different, Penicillium SPP-1 and SPP-2 were later established through molecular analysis to contain the same DNA nucleotide sequences and were both identified as P. commune. On the other hand, Penicillium SPP-4 and SPP-5 were both identified as P. concavorugulosum. This, therefore, means SPP-1 and SPP-2 are genetically the same Penicillium species. Similarly, SPP-4 and SPP-5 were also identified to be genotypically the same species. The morphological differences probably occurred because of environmental effects. This deduction is based on the reports that the growth of certain fungal microorganisms in different growth media conditions have been found to affect filamentous fungi mycelial development and growth rate (Agudelo-Escobar et al., 2017). It is, therefore, possible that the source of the respective Penicillium species could have influenced the morphological colony characteristics when grown in PDA. There is also a possibility of the existence of sub-biotype or strains within these Penicillium fungal species that were identified as SPP-1 and SPP-2. These fungal biotypes could be genetically similar but possessing varying P. commune strain properties. This is particularly so as they were assigned with different GenBank Accession numbers (MK660351.1 and MK660335.1) respectively. For example, 23 genetic diversity of F. oxysporum strains that are pathogenic and non-pathogenic have been reported on various studies. The F. oxysporum pathogenic strain and some non-pathogenic i.e. endophytic strain have been established to be genetically similar but differ in their eco- physiological impact on the host (Nirmaladevi et al., 2016). The possibility of the existence of different strains of Penicillium species is strengthened by Alapont et al. (2014) who established the existence of 24 strains of P. commune. The occurrence of various P. commune strains in the soil rhizosphere in semi-arid eco-region of sub-Saharan Africa should therefore be further investigated. The four Penicillium species and one A. fumigatus species that were identified in the study should be investigated for their suppressive properties/effect against F. oxysporum. Penicillium and Aspergillus species are known for their ability to produce secondary metabolites that contain the potential to influence growth and survival of other fungal microorganisms (Pitt et al., 2000; Pitt, 2002; Svahn, 2015). Different soil microorganisms have been noted to vary in the suppressive effect on various soil-borne pathogens. These different suppressive properties include the following: Antagonism, myco-parasitism and ecological competitiveness (Frisvad et al., 2007). These characteristics have been noted to vary between fungal species including Penicillium species within the same genera (Frisvad et al., 2006). In addition to the study on the suppressive effect, they should also be evaluated for phytopathological biosafety i.e. negative effect on commonly grown vegetables. This investigation should be considered on a wide range of soil and climatic factors including the semi-arid regions. Costa and Nahas (2012) reported on the importance of soil and environmental factors on the adaptations, growth and survival mechanisms of fungal microorganisms. Based on the differences in morphological features and similarities in molecular identification in this study, the test fungal isolates have therefore been named as follows: Table 2. 4: Names of the Penicillium fungal isolates used in this dissertation Isolate Predicted organism Name in dissertation Isolate 1 (SPP-1) P. commune P. commune-1 Isolate 2 (SPP-2) P. commune P. commune-2 Isolate 4 (SPP-4) P. concavorugulosum P. concavorugulosum-1 Isolate 5 (SPP-5) P. concavorugulosum P. concavorugulosum-2 24 CHAPTER THREE In-vitro analysis of the efficacy of four Penicillium spp. and Aspergillus fumigatus on Fusarium oxysporum f.sp. radicis lycopersici (FORL). 3.1. INTRODUCTION Penicillium and Aspergillus species are part of many filamentous fungi that produce a range of secondary metabolites and mycotoxins that result in various influences on plants, soil and other various microbes (Frisvad et al., 2006; Frisvad et al., 2007). These secondary metabolites include Fumagillin/Pseurotin, Aflatoxins etc. and cause a variety of interactions/relationships such as antibiosis, competition and mycoparasitism between microorganisms (Whipps, 2001, Perotto et al., 2013, Verma et al., 2020). Antibiosis may be defined as an antagonistic response induced by microbial secondary metabolites which neutralizes metabolic activities of other microorganisms (Verma et al., 2020). Mycotoxins have been defined as secondary metabolites that are produced by fungal microorganisms that cause diseases in humans, animals, and plants (Kamei & Watanabe, 2005; Alshannaq et al., 2017). Aflatoxins, gliotoxins, ochratoxins etc. are many of various and recognizable toxins produced by Penicillium and Aspergillus species and they have been reported to also have antimicrobial effects as well as immune-suppressive properties on other microorganisms (Kamei & Watanabe, 2005). These species are of economic importance in agriculture because of their multifunctional properties that may be beneficial as well as harmful to plants and other soil micro fauna (Bhatnagar et al., 2002). For example, some pathogenic effect on plants may be exerted by various Penicillium species due to metabolite influence on the physiological growth as reported by Shuping and Eloff (2017). This may be classified as an economic effect as economic losses are experienced when yields decrease. Two of the several pathogenic Penicillium species that cause citrus green rot and onion rot/decay are P. digitatum, P. italicum and P. glabrum, resulting in economic loses (Agrios, 2005). Studies on Penicillium and Aspergillus species have exhibited their abilities to positively influence plant growth and development by production of certain phytohormones and secondary metabolites (Kumar et al., 2018). These fungal species inherently possess the potential to be developed as both plant growth enhancers and root protection against soil-borne pathogens. 25 3.1.1. Specific objective i. To carry out in- vitro analysis of the effect of four Penicillium spp isolates and Aspergillus fumigatus against Fusarium oxysporum f.sp. radicis lycopersici (FORL). 3.2. MATERIALS AND METHODS The five fungal isolates viz. P. commune-1 (MK660351.1), P. commune-2 (MK660335.1), A. fumigatus (MN178806.1), P. concavorugulosum-1 (MK841454.1) and P. concavorugulosum- 2 (MK841454.1) were used in an in-vitro study to evaluate their efficacy as biocontrol agents against F. oxysporum. f.sp. radicis lycopersici (FORL). 3.2.1 Experimental description a. Experimental Design and layout An in-vitro experiment was carried out using each of the respective Penicillium species isolated from different soil types, i.e. P. commune-1, P. commune-2, A. fumigatus, P. concavorugulosum-1 and P. concavorugulosum-2. Each of the respective fungal isolates was cultured in PDA and their mycelia cut into 2-cm diameter discs and analysed for their suppressive effect against F. oxysporum. This was carried out by placing the respective test fungal isolates alongside two (2) centimetre diameter discs of F. oxysporum. The discs were each placed 3cm apart in each petri dish that made up an experimental unit. The experimental treatment combinations were computed as follows: FT0, FT1, FT2, FT3, FT4, and FT5; where F= F. oxysporum, T1= P. commune-1; T2= P. commune-2; T3= A. fumigatus; T4= P. concavorugulosum-1 and T5= P. concavorugulosum-2. Making a total of six treatment combinations. These treatment combinations were each replicated five times making a total of thirty (30) experimental units and these were laid out in a Completely Randomized Design (CRD) in an incubator set at 25℃ - 27℃ for ten (10) days. A B 26 C D Figure 3. 1: Experimental setup of the dual anti-fungal analysis: Prior incubation. (A) F. oxysporum discs in PDA growth media (control). (B) P. commune-1 and F. oxysporum discs in PDA growth media. (C) P. commune-2 and F. oxysporum discs in PDA growth media. (D) A. fumigatus and F. oxysporum in PDA growth media. b. Data collection and analysis i. Mycelial growth assessment was carried out on a two-day interval for ten days whereby the diameter of F. oxysporum and respective Penicillium species and A. fumigatus were measured using a Vernier calliper. ii. The correlation coefficient between the growth of pathogen and respective test antagonists was determined using Pearson's correlation coefficient. iii. Inhibition percentages were calculated using the controls- pathogen growing alone and pathogen growing with isolate respectively using the formula: ?̅? 𝑇1(𝐴0) − 𝑋 ̅𝑇1(𝐴1) 𝐼𝑃 = × 100 (3.1) ?̅? 𝑇1(𝐴0) Where: • IP = Inhibition percentage • 𝑋 ̅ = average/mean • T1(A0) = Pathogen growing alone • T1(A1) = Pathogen growing with respective isolate iv. Analysis of variance (ANOVA) was carried out to test the significance of the relationship/effect at 5% probability level using GENSTAT software seventeenth edition (Copyright 2014, VSN International Ltd.). 27 3.3 RESULTS 3.3.1 Dual antifungal relationships of selected test isolates against F. oxysporum Mycelial growth diameter, mycelial form and various growth relationships such as antibiosis, mycoparasitism and competition of the respective species were assessed at a two-day interval for a week. Fig.3.2(a) and Fig.3.2 (b) show mycelial discs growth of isolated Penicillium and Aspergillus spp against F. oxysporum in PDA growth media after 10 days of incubation. a. Dual antifungal relationship assessments. Figure 3.2(a) and (b) show various interactions between the five isolates with F. oxysporum f. sp. radicis lycopersici (FORL). A B C Figure 3.2(a): Fungal growth and interactions between selected fungal species after 7 days: (A): P. concavorugulosum-2 and F. oxysporum, (B): A. fumigatus and F. oxysporum, (C): P. concavorugulosum-1 and F. oxysporum. 28 D D E F Figure 3.2(b): Fungal growth and interactions between selected fungal species after 7 days: (D): P. commune-1 and F. oxysporum, (E): P. commune-2 and F. oxysporum, (F): F. oxysporum growing alone. Rapid mycelial growth and multiple suppressive characteristics i.e. competitiveness, antibiosis and mycoparasitism were noted for P. concavorugulosum-2 against F. oxysporum. P. 29 concavorugulosum-2 rapidly grew around and over F. oxysporum while slowly reducing its growth and size (Fig 3.2b (A). Multiple suppressive effects were also exhibited by A. fumigatus against F. oxysporum where strong competitive, antibiosis and mycoparasitic effect were noted. A. fumigatus rapidly grew around F. oxysporum while slowly covering the isolate (Fig 3.2b (B). Slow growth was noted on P. concavorugulosum-1 as it grew away from F. oxysporum, exhibiting signs of antibiosis between fungal isolate and F. oxysporum f.sp. radicis lycopersici (FORL) [Fig 3.2b (C)] Notably, antibiosis effect of F. oxysporum against P. commune-1 was evident. The decline of P. commune-1 mycelial growth when compared to F. oxysporum was indicative of its restricted growth (Fig 3.2a (D). Less growth rate was further noted on P. commune-2 when compared to F. oxysporum. There was an indication of antibiosis and competitiveness exhibited by F. oxysporum (Fig 3.2a (E). b. Mycelial growth rate assessments The mycelial growth rate of the respective isolates and F. oxysporum f.sp. radicis lycopersici (FORL), and their ecological relationships are shown in Figures (3.3 – 3.8). An inversely proportional relationship between P. concavorugulosum-2 and F. oxysporum was noted. With a rapid growth rate for P. concavorugulosum-2, there was a corresponding decline of F. oxysporum (Fig 3.3). 9 8 7 6 5 4 3 2 1 0 2 4 6 8 10 Assessment (1=2 days) Fusarium oxysporum Penicillium concavorugulosum2 Figure 3.3: Mycelial growth comparison of P. concavorugulosum against F. oxysporum f.sp. radicis lycopersici (FORL): Growth rate and interaction collected at a two-day interval for 10 days. 30 Mycelial diameter (cm) A. fumigatus exhibited a continual increase on all the assessments whereas F. oxysporum followed a parabolic path with a peak of 3,92cm at assessment 3. A gradual decline was however noted at assessment 4 and 5 for F. oxysporum (Fig 3.4). 9 8 7 6 5 4 3 2 1 0 2 4 6 8 10 Assessment (1=2 days) Fusarium oxysporum Aspergillus fumigatus Figure 3.4: Mycelial growth comparison of A. fumigatus against F. oxysporum f.sp. radicis lycopersici (FORL): Growth rate and interaction collected at two-day interval for 10 days. Although A. fumigatus exhibited multiple suppressive characteristics against F. oxysporum, P. concavorugulosum-1 was not as strongly expressive. This is evident by the higher F. oxysporum growth rate (Fig 3.5). 8 7 6 5 4 3 2 1 0 2 4 6 8 10 Assessment (1= 2 days) Fusarium oxysporum P. concavorugulosum1 Figure 3.5: Mycelial growth comparison of P. concavorugulosum-1: against F. oxysporum f.sp. radicis lycopersici (FORL). Growth rate and interaction collected at a two-day interval for 10 days. 31 Mycelial diameter (cm) Mycelial diameter (cm) P. commune-1 exhibited a reduced growth rate against F. oxysporum, this indicates the rapid growth of the pathogen. Competition in favour of F. oxysporum was noted between the species. This resulted in subdued mycelial growth of P. commune-1 (Fig 3.6). 9 8 7 6 5 4 3 2 1 0 2 4 6 8 10 Assessment (1= 2 days) Fusarium oxysporum Penicillium commune1 Figure 3.6: Mycelial growth comparison of P. commune-1 against F. oxysporum f.sp. radicis lycopersici (FORL). Growth rate and interaction of P. commune1 against F. oxysporum collected at two-day interval for 10 days. A gradual decline in mycelial growth was noted on P. commune-2 whereas a steep elevation was noted on F. oxysporum, expressing less suppressiveness of P. commune-2 on F. oxysporum. (Fig 3.7). 9 8 7 6 5 4 3 2 1 0 2 4 6 8 10 Assessment (1=2 days) Fusarium oxysporum Penicillium commune2 Figure 3.7: Mycelial growth comparison of P. commune-2 against F. oxysporum f.sp. radicis lycopersici (FORL): Growth rate and interaction collected at a two-day interval for 10 days. 32 Mycelial diameter (cm) Mycelial diameter (cm) Varying mycelial growth rates of fungal isolates against F. oxysporum f.sp. radicis lycopersici (FORL) shown in (Figures 3.3 – 3.7) depict and highlight the range of suppressiveness of the respective isolates against F. oxysporum. 3.3.2 Correlation coefficient Correlation analysis determines the statistical relationship or association and strength between two variables. Statistical relationships of the test isolate against F. oxysporum f.sp. radicis lycopersici (FORL) were therefore determined and are exhibited in Figures 3.8 to Fig 3.12. 8 7 6 R² = 0,6166 5 4 3 2 1 0 0 1 2 3 4 5 6 7 8 9 10 F. oxysporum mycelial diameter (cm) Figure 3.8: Moderate positive relationship between P. commune-1 and F. oxysporum f.sp. radicis lycopersici (FORL). r = 0.785 8 7 6 5 R² = 0,3348 4 3 2 1 0 0 1 2 3 4 5 6 7 8 F. oxysporum mycelial diameter (cm) Figure 3.9: Weak positive association between P. concavorugulosum-1 and F. oxysporum f.sp. radicis lycopersici (FORL). r = 0.579 33 P. concavorugulosum-1 mycelial diameter (cm) P. commune-1 mycelial diameter (cm) 10 9 8 R² = 0,0038 7 6 5 4 3 2 1 0 0 1 2 3 4 5 6 7 F. oxysporum mycelial diameter (cm) Figure 3.10: Very weak positive relationship/association between A. fumigatus and F. oxysporum f.sp. radicis lycopersici (FORL). r = 0.062 3,5 3 2,5 R² = 0,0393 2 1,5 1 0,5 0 0 1 2 3 4 5 6 7 8 9 F. oxysporum mycelial diameter (cm) Figure 3.11: Very weak negative relationship/association between P. commune-2 and F. oxysporum f.sp. radicis lycopersici (FORL). r = −0.198 10 9 8 7 6 5 R² = 0,1845 4 3 2 1 0 0 1 2 3 4 5 6 7 8 F. oxysporum mycelial diameter (cm) Figure 3.12: Weak negative association between P. concavorugulosum2 and F. oxysporum f.sp. radicis lycopersici (FORL). r = −0.429 34 P. concavorugulosum2 P. commune-2 mycelial A. fumigatus mycelial mycelial diameter (cm) diameter (cm) diameter (cm) Although there was an evident correlation between the respective test isolates and F. oxysporum f.sp. radicis lycopersici (FORL) albeit relatively weak, there was notable inhibition effects due the test fungal isolates. 3.3.3 Inhibition percentage Percentage inhibitions of the test isolates against F. oxysporum are graphically presented in Fig 3.13 where P. concavorugulosum2 and A. fumigatus exhibited the highest inhibition percentage against F. oxysporum. The lowest inhibition was noted on P. commune1 against F. oxysporum f.sp. radicis lycopersici (FORL). Inhibition percentage may be explained as the measure of inhibitory influence by subtracting inhibited growth from normal growth of the same object and dividing by the normal growth of the same object (Himratul-Aznita et al., 2011, Harun et al., 2013). 14,09 67,9 65,36 29,56 P. commune1 P. commune2 A. fumigatus P. concavorugulosum1 P. concavorugulosum2 Figure 3.13: Inhibition percentages of the four Penicillium isolates and A. fumigatus against F. oxysporum f.sp. radicis lycopersici (FORL). 3.4 DISCUSSION The in-vitro results exhibited various relationships such as competition, antibiosis, and mycoparasitism of the respective test isolates against F. oxysporum f.sp. radicis lycopersici (FORL) [Fig 3.2(a) and 3.2(b)]. This fungus-on-fungus interaction may probably be explained by the production of labile substances that impact the development and survival of the 35 9,01 microorganisms that they come into contact with (Zeilinger-Migsich & Mukherjee, 2014; Schmidt et al., 2015). A. fumigatus and P. concavorugulosum-2 were noted to overgrow F. oxysporum, which could possibly be indicative of mycoparasitism/mycoparasitic behavior (Fig3.2(a), insert A and B). This is explained as a relationship that occurs when one fungal species parasitizes on another (Moore et al., 2011; Qualhato et al., 2013). This was probably because of the production of gliotoxin by A. fumigatus. Gliotoxin is a pleiotropic mycotoxin that is produced by A. fumigants and has been reported to cause cytotoxicity in mammals and various other microorganisms (Nieminen et al., 2002; Bulgari et al., 2020). This could have caused the rapid degradation and reduced growth of F. oxysporum observed in [Fig 3.2(a) insert B]. The overgrowth of P. concavorugulosum-2 against F. oxysporum [Fig 3.2(a), insert A] could also be because F. oxysporum released extrolites that acted as a nutritional source for P. concavorugulosum-2. A. fumigatus and P. concavorugulosum-2 demonstrated rapid growth and a feeding mechanism on F. oxysporum [Fig 3.2(a), insert A and B] as their mycelia expressed a degradation effect. This was noted with mycelia of these respective isolates overlaying F. oxysporum mycelia. The faster growth rate exhibited by A. fumigatus and P. concavorugulosum-2 when grown against F. oxysporum could be explained by the differences in inherent biological properties that could have influenced their parasitism, adaptation and competitiveness. Additionally, the two test isolates could have possibly catabolized metabolites produced by F. oxysporum to decrease its growth and survival rate. Studies by Chatterjee et al. (2016) reported that species-specific metabolite catabolism by the producer or an organism in the same growth environment is possible. The good performance of P. concavorugulosum-2 against F. oxysporum is indicative of its potential use as a biocontrol agent against the pathogen. The Penicillium species could be used as a single agent or be used in combination with other Penicillium isolates (e.g. P. digitatum) that also showed a suppressive effect against Fusarium pathogens. It is expected that a synergistic effect of collective activity against F. oxysporum of the combined fungal species could be generated. Further studies should therefore be undertaken to determine whether such synergistic effect could be achieved. Furthermore, in-vivo analysis of the antifungal efficiency of P. concavorugulosum-2 and A. fumigatus in the plant rhizosphere should also be carried out. Besides, their effect on germination and the establishment of various other vegetables of economic importance should also be investigated. Mycelial disc growth comparison of A. fumigatus against F. oxysporum (Fig 3.4) showed that A. fumigatus had a faster growth rate throughout all five (5) assessments. P. 36 concavorugulosum2’s mycelial growth also exhibited higher and rapid growth than F. oxysporum (Fig 3.3). This is indicative that A. fumigatus and P. concavorugulosum-2 contain stronger competitive and anti-microbial characteristics against the growth of F. oxysporum. Similar ecological relationships have been established in Trichoderma studies against certain pathogenic fungi. The competitive advantage of a biocontrol agent against a pathogen has been established in the studies on Trichoderma species. Go et al. (2019) established that some Trichoderma species have expeditious growth mechanisms and can utilize available resources faster while decreasing the growth of another pathogenic fungal species. P. concavorugulosum-2 and A. fumigatus could therefore possess similar characteristics. Although a positive outcome was noted on P. concavorugulosum-2 and A. fumigatus, a weak development rate of P. commune-1 was noted against F. oxysporum (Fig 3.6). This was probably because a competitive interaction was triggered on both fungal species which triggered their chemical defenses, therefore reducing the growth of P. commune-1 while the growth of F. oxysporum increased. Künzler, (2018) reported on various fungi defense mechanisms when sensing microbial competition. The dominant action being chemical defense. Competition occurs when one organism outgrows and survives more aggressively than the other by utilizing vital resources such as carbon, trace elements and space faster than the other (Hassani et al., 2018). This could therefore mean that occupation of space and utilization of nutrients by F. oxysporum could occur faster than the microbial bio-control agent (P. commune-1) thus increasing the chances of disease occurrence under field conditions. This competitive aspect however depends on growth conditions that the microorganisms are subjected to, which can either enhance or depress their growth as well as disease occurrence (Alkorta et al., 2017; Köhl et al., 2019). The antibiosis interaction (growth inhibition zone – colonies growing away from each other) of P. commune-2 against F. oxysporum that was established (Fig 3.7) was possibly because of the production of metabolites that can weaken and reduce competitiveness and growth of other microorganisms. For example, Perincherry et al. (2019) reported on the production of toxic secondary metabolites by Fusarium species during various interactions with plants or other microbes. These metabolites can therefore influence/weaken the growth of other microbial species. Fusarium species have been reported to produce mycotoxins such as zearalenone, deoxynivalenol, fumonisins, trichothecenes, etc. that can invade cell membranes, alter microbial growth patterns and increase pathogen multiplication (Mendoza et al., 2015; Perincherry et al., 2019). Therefore, this might have given F. oxysporum growth and 37 multiplication advantage over P. commune-2. Furthermore, the growth inhibition zone observed in (Figure 3.2 insert E) may be explained by the production of inhibitory metabolites by F. oxysporum that led to the growth-free zone, allowing both species to grow but giving F. oxysporum excess growth (Mendoza et al., 2015; Perrone and Susca, 2017). There is a variation in the strength of the relationship between test isolates and F. oxysporum ranging from weakly negative to moderate positive associations. Correlation between A. fumigatus and F. oxysporum showed a very weak positive relationship where r = 0.062 (Fig 3.11) compared to moderate correlation value between P. concavorugulosum-2 and F. oxysporum that showed a moderate negative relationship of r = −0.43 (Figure 3.13). This means P. concavorugulosum2 expressed a range of fungal suppressive properties i.e. competitive, antibiotic and mycoparasitic properties. A similar expression was established between A. fumigatus and F. oxysporum albeit at a weaker level (Figure 3.11). The moderate positive association between P. commune-1 and F. oxysporum shows no indication of pathogen suppressiveness (Figure 3.9). There was no evident relationship between P. commune-1 and F. oxysporum on all the five assessments. There is, however, a relatively weak negative association of P. commune-2 and F. oxysporum indicating a decline of P. commune-2 and an increase of F. oxysporum The negative correlation established between P. concavorugulosum-2 and F. oxysporum is indicative of the inhibition ability of the test fungus against the pathogen. The inhibition characteristics of a test isolate exerted on F. oxysporum that was calculated and expressed in percentages showed P. concavorugulosum-2 had the highest inhibitory effect against F. oxysporum (67.9%) followed by A. fumigatus (65.36%)[ Figure 3.14]. The other test isolates’ inhibition was not very significant as they ranged from 9% to 29%. A conclusion can be drawn that P. concavorugulosum-2 and A. fumigatus contain potential antagonistic properties that enable suppression of growth of F. oxysporum (Figure 3.2b insert A and B). These fungal isolates should be considered as good candidates for development as commercial biocontrol inoculum as individuals or in combination. However, these species’ suppressive properties should be evaluated under natural soil conditions. In-vivo studies will determine their influence in the presence of various soil microorganisms and under different soil factors. They should also be investigated for their phytopathological and ecological biosafety status. A. fumigatus was however reported to produce mycotoxins that are harmful to 38 human health when exposure to high amounts occurs. It is therefore recommended to exclude it from further studies. 39 CHAPTER FOUR Screening of pathogenicity of four Penicillium isolates and one Aspergillus fumigatus species on selected vegetables. 4.1 INTRODUCTION Seed germination is one of the most important stages of plant establishment and growth. It is a complex physiological process that is easily influenced as well as affected by various factors such as moisture availability, oxygen, light, and the presence or absence of plant pathogens (Ali and Elozeiri, 2017, Bareke, 2018). Soil-borne pathogens are amongst the most devastating pathogens for both field and vegetable crops and result in significant losses when infection occurs during the germination process. Soil-borne pathogens such as F. oxysporum are amongst the most destructive phytopathogenic fungi that are abundant in the soil. The species have a wide range of plant hosts due to its several specialized forms (formae specialis (f.sp.) (Pietro et al., 2003; Rana et al., 2017) that enables it to attack a wide range of vegetables, cereal crops as well as ornamentals. The utilization of fungal microorganisms with different ecological properties i.e. secondary metabolite production, mycoparasitism, competition or antibiosis as biological control agents has been initiated in order to mitigate the extensive use of chemical control methods (Larena et al., 2003; Heydari and Pessarakli, 2010). However, their behaviour and effectiveness have been reported to vary under different ecological interactions. A study by Knudsen and Dandurand (2014), reported the detailed influence of fungal biocontrol on soil-borne pathogens. The study highlighted that the complexity of the ecosystem i.e. varying environmental conditions such as temperature, pH and a variety of microorganisms may negatively or positively influence the behaviour of these biocontrol agents thus impacting on its effectiveness. For example, Brunner et al. (2005) indicated the short-fall of various Trichoderma species on glucose oxidase products, thus limiting utilization of its disease control and plant growth-promoting properties. The study, therefore, looked at enhancing the disease control effect of Trichoderma harzianum to its directiveness on fungal pathogen inhibition and to incite resistance in plants. 40 Furthermore, the impact of the complexity of microbial interaction and rhizosphere interaction was explained by Whipps (2001), highlighting that fungal biocontrol agent-fungal pathogen association governed by competition, antibiosis, induced resistance and multiple microbe interactions have different modes of action. Therefore, these different modes of action influence the response of the host plant to the biocontrol agent. In search of alternative bio-control agents that are not harmful to plant growth and development, the test fungi that were investigated in chapter three must be screened for their bio-phytopathological and ecological safety. This study was therefore undertaken to examine the pathogenic effect of all the test fungi i.e. Penicillium species: P. commune-1, P. commune- 2, P. concavorugulosum-1, P. concavorugulosum-2 and A. fumigatus had on germination and seedling growth of three vegetable seeds: Spinacia oleracea, Beta vulgaris and Solanum lycopersicum. 4.1.1 Specific objectives: (i) To investigate pathogenic effect of four (4) Penicillium species and A. fumigatus on the germination of S. oleracea, B. vulgaris and S. lycopersicum. (ii) To investigate pathogenic effect of four (4) Penicillium isolates and A. fumigatus on the post-emergence seedling growth. 4.2 MATERIALS AND METHODS 4.2.1 Inoculum preparation and seed inoculation The respective four (4) Penicillium species that were identified in chapter 2 of this dissertation viz. P. commune-1 (MK660351.1), P. commune-2 (MK660335.1), P. concavorugulosum-1 (MK841454.1), P. concavorugulosum-2 (MK841454.1) and A. fumigatus (MN178806.1), were prepared by scraping mycelia of the respective actively growing cultures into 50 ml individual beakers. A sub-sample of 10g fungal mycelia of the respective species were mixed with 5g of talc powder. The talc powder was added as seed binding material to respective mycelial samples. 20 ml of sterile water was poured into each respective mixture of mycelia and talc powder. The respective suspensions were stirred until homogenous slurries were achieved. 41 Seed surface was sterilized using 70% ethanol for 3 minutes (Oyebanji et al., 2009, Jan et al., 2013). A batch of 30 sterilized seeds each for the selected vegetable types i.e. Spinacia oleracea (STAR 1801), Beta vulgaris (Detroit dark red) and Solanum lycopersicum (Moneymaker) were individually added into 50ml beakers containing respective homogenous mixtures of the slurry treatments i.e. slurry with mycelial samples of the following fungal isolates; P. commune-1, P, commune-2, A. fumigatus, P. concavorugulosum-1 and P. concavorugulosum-2. The slurry coated seeds were placed on a sterilized laminar flow cabinet to dry. These were kept in vials for later use to carrying out germination tests. 4.2.2 Experimental description and design Three sub-experiments were laid out whereby each of the three vegetable seeds i.e. S. oleracea, B. vulgaris and S. lycopersicum were subjected to the following slurry treatments: C, P1, P2, P3, P4 and P5, where C= control, P1= P. commune-1. P2= P. commune-2, P3= A. fumigatus, P4= P. concavorugulosum-1 and P5= P. concavorugulosum-2. Five (5) respective test fungi slurry treated seeds and the control treatment were placed in between paper towels that were rolled around 8ml test tubes. Each of the respective sub-experimental units was replicated three (3) times making a total of eighteen (18) experimental units. These experimental units were placed in beakers containing 4mm level of distilled water that moistened the paper towels through capillary action. The moistened paper towel provided suitable conditions for seed germination. This seed germination technique is described in detail by Bicksler (2011). The respective experimental units for each of the sub-experiment were laid in a completely randomized design (CRD) in an incubator set at a temperature of 25℃. Figure 4. 1: Seed germination experimental setup. 42 Germination percentage of the respective test fungi treated vegetable seeds was assessed for all the three sub-experiments to screen for phytopathological safety of different vegetable seeds when exposed to all the test fungal isolates. The effect of the test fungal isolates on respective vegetable seeds was assessed by counting the number of germinated seeds at a two-day interval for a period of two weeks. The radicle and plumule lengths for all the selected vegetables were assessed using vernier calipers. Disease occurrence or pathogenicity of the test isolates was assessed by checking for necrosis and discoloration on the radicles and plumules of each respective vegetable. 4.2.3 Data collection i. Germination rate was carried out at a two-day interval (Number of germinated seeds per assessment). The germination percentage was calculated. ii. The growth rate of respective radicles and plumules of the germinated seeds. iii. Vigour indices were calculated using the following mathematical formula as described and explained by (Khokhar et al., 2013, Rao et al., 2014) and suggested by (Abdul-Baki and Anderson, 1973): Vigour index (VI) determines the potential for rapid and uniform germination/emergence under various conditions (Chen et al., 2015, Huang et al., 2017). It was calculated using the addition of the mean length of plumule and mean length of radicles multiplied by germination percentage (Abdul-Baki and Anderson, 1973). VI = (lp + lr) *100 (4.2) Where VI= vigour index lp= length of plumule (cm) lr= Length of radicle (cm) 4.2.4 Statistical Analysis Analysis of variance (ANOVA) of the data from all the experiments was carried out using GEN STAT software seventeenth edition (VSN International Ltd.) to test the significant difference of the effect of all treatments on germination and growth of the seed of the three vegetable 43 types: germination rate, plumule and radicle length. The mean comparison was interpreted by the use of Bonferroni test at 5% probability level. 4.3 RESULTS Among the three vegetables selected for the biosafety study, treatments had a statistically significant effect on the germination, radicle and plumule growth of S. oleracea and B. vulgaris. There was, however, a relatively non-significant weak positive effect on S. lycopersicum. 4.3.1 Effect of different treatments on seed germination of the selected vegetables a. ANOVA for germination of selected vegetables: S. oleracea and B. vulgaris Analysis of variance of the effect of four Penicillium isolates: P. commune-1, P. commune-2, P. concavorugulosum-1, P. concavorugulosum-2 and A. fumigatus on the germination of S. oleracea and B. vulgaris showed statistically significant effects on seed germination ( P <.001) [Tables 4.1 and 4.2]. Treatment means comparison for S. oleracea and B. vulgaris are presented in Table 4.3. Means with the same superscripts are not statistically significantly different. Table 4. 1: ANOVA on the effect of all treatments on S. oleracea germination Source of variation d.f. s.s. m.s. v.r. F pr. Rep stratum 2 1.000 0.500 0.41 Rep. *Units* stratum Treatment 5 30.7619 6.1524 5.10 <.001 Residual 118 142.238 1.205 Total 125 174.0000 Table 4. 2: ANOVA on the effect of all treatments on Beta vulgaris seed germination Source of variation d. f. s.s. m.s. v.r. F pr. Rep stratum 2 6.778 3.389 3.23 Rep. *Units* stratum Treatment 5 93.111 18.622 17.74 <.001 44 Residual 118 123.889 1.050 Total 125 223.778 Table 4. 3: Mean comparison and grouping of S. oleracea and B. vulgaris seed germination Treatment S. oleracea Treatment B. vulgaris germination germination means* means* P. concavorugulosum2 a4.048 P. commune2 a 2.381 P. concavorugulosum1 a4.238 P. concavorugulosum1 b 3.429 A. fumigatus ab4.333 P. commune1 b 3.667 Control ab4.810 A. fumigatus b 3.714 P. commune1 b5.286 P. concavorugulosum2 b 4.238 P. commune2 b c5.286 Control 5.238 Comparison-wise error rate = 0.0033 *The mean comparison treatments with the same superscripts are not significantly different from one another. b. Assessment of germination rate of S. oleracea and B. vulgaris The trend of the germination rate of S. oleracea is graphically presented in figure 4.2. P. commune-1 and P. commune-2 exhibited a higher stimulatory effect on germination of S. oleracea seeds than P. concavorugulosum-1, P. concavorugulosum-2 coated seeds and control. Among the various Penicillium isolates and A. fumigatus used as slurry seed treatments, control, P. commune-1, and P. commune-2 recorded the highest germination percentages (100%) on S. oleracea (Fig 4.1). 45 120 100 80 60 40 20 0 1 2 3 4 5 6 7 Time (days) Control P. commune1 P. commune2 A. fumigatus P. concavorugulosum1 P. concavorugulosum2 Figure 4.2: S. oleracea seed germination rate over a period of 14 days. On the other hand, the control treatment showed full seed germination (100%), whereas P. commune-2 inoculated seeds exhibited low germination percentage compared to all the treatments (Figure 4.2). 120 100 80 60 40 20 0 1 2 3 4 5 6 7 Time (days) Control P.commune1 P. commune2 A. fumigatus P. concavorugulosum1 P. concavorugulosum2 Figure 4.3: B. vulgaris seed germination rate. Germination was collected at the two-days intervals for two weeks. Positive germination was noted for all treatments on S. lycopersicum; however, a not statistically significant difference output was observed on seed germination. 4.3.2 Effect of the treatments on the radicle and plumule response a. ANOVA for S. oleracea and B. vulgaris radicle and plumule growth assessments In addition to the stimulatory effect of different Penicillium and Aspergillus fungal species on germination of S. oleracea and B. vulgaris seeds, their effect was also noted on the plumule growth rate. A non-statistically significant effect was however noted on the radicle for all three vegetables. Analysis of variance on the effect of the treatments on plumule response shows a 46 Germination percentage (%) Germination percentage (%) statistically highly significant effect on S. oleracea and B. vulgaris (p<.001) (Table 4.4) and (Table 4.5). Table 4. 4: ANOVA on the effect of different treatments on S. oleracea plumule response. Source of variation d.f. s.s. m.s. v.r. F pr. Assessment stratum 6 228.7838 38.1306 52.56 Assessment ⃰Units ⃰stratum Treatment 5 75.8088 15.1618 20.90 <.001 Residual 114 82.7072 0.7255 Total 125 387.2998 Table 4. 5: ANOVA showing the effect of all treatments on plumule growth. Source of variation d.f. s.s. m.s. v.r. F pr. Rep stratum 2 0.5303 0.2652 0.94 Rep. *Units* stratum Treatment 5 219.2228 43.8446 155.31 <.001 Residual 118 33.3109 0.2823 Total 125 253.0639 b. Radicle and Plumule growth assessment: S. oleracea and B. vulgaris S. oleracea radicle and plumule growth A graphical presentation of S. oleracea radicle and plumule response is shown in figure 4.4(a) and figure 4.4(b). For instance, Control, P. commune1 and A. fumigatus treatments showed higher radicle and plumule growth response than P. commune2, and P. concavorugulosum1 and P. concavorugulosum2 treatments. 47 30 25 20 15 10 5 0 1 2 3 4 5 6 7 Time (days) Control P. commune1 P. commune2 A. fumigatus P. concavorugulosum1 P. concavorugulosum2 Figure 4.4(a): Two weeks assessment of S. oleracea radicle growth. 30 25 20 15 10 5 0 1 2 3 4 5 6 7 Time (days) Control P. commune1 P. commune2 A. fumigatus P. concavorugulosum1 P. concavorugulosum2 Figure 4.4 (b): Two weeks assessment of S. oleracea plumule growth. B. vulgaris radicle and plumule growth assessment On the contrary, P. concavorugulosum-2 and A. fumigatus coated seeds exhibited high radicle growth whereas a high plumule growth was noted on P. concavorugulosum-1 and P. 48 Radicle length (cm) Plumule length (cm) concavorugulosum-2 treated B. vulgaris seeds (Fig 4.6) and (Fig 4.7). Control treatment exhibited the highest growth on both the radicle and plumule for B. vulgaris. 16 14 12 10 8 6 4 2 0 1 2 3 4 5 6 7 Time (days) Control P. commune1 P. commune2 A. fumigatus P. concavorugulosum1 P. concavorugulosum2 Figure 4.5(a): B. vulgaris radicle growth assessed at two-day intervals for two weeks. 16 14 12 10 8 6 4 2 0 1 2 3 4 5 6 7 Time (days) Control P. commune1 P. commune2 A. fumigatus P. concavorugulosum1 P. concavorugulosum2 Figure 4.5(b): B. vulgaris plumule growth assessed at two-day intervals for two weeks. 4.3.3 Effect of the treatments on seedling size and health: Seedling Vigour a. Seeding inspection and diagnosis 49 Radicle length (cm) Radicle length (cm) There was no necrosis nor discoloration noted on S. oleracea radicle and plumule for all the treatments (Fig 4.6). Figure 4. 6: Spinacia oleracea seedlings showing no signs and symptoms of disease occurrence Evidence of growth suppression and the presence of parasitism were noted on B. vulgaris radicle and plumule for all treatments. The control treatment also showed some evidence of necrosis on the plumule and radicle [Figure 4.7(a) & (b)]. The seeds and seedlings exhibited reduced and slower germination, discoloration and necrosis on the radicles and plumules. Discoloration Necrosis Discoloration B A Figure 4. 7(a): (A) Discoloration symptoms on control treatment. (B) Radicle and plumule necrotic signs on P. commune1 treatment. 50 Necrosis Discoloration Necrosis Parasitism A B Figure 4.7(b): (A) Parasitism, discoloration and necrosis symptoms on A. fumigatus treated seeds. (B) Necrosis signs noted on seeds treated with P. concavorugulosum1. The biosafety inspection on S. lycopersicum showed no evidence of infection for all treatments (Fig 4.8). Figure 4. 8: S. lycopersicum germinated seedlings. b. Vigour index assessment for S. oleracea, B. vulgaris and S. lycopersicum To further analyse the effect of different Penicillium and Aspergillus isolates on the germination, plumule, and radicle growth rate, the seedling vigour (vigour index) was 51 calculated. A high vigour index was recorded for S. oleracea treated with P. commune-1 and the control in comparison to other treatments where a low vigour index was recorded on P. concavorugulosum-2 treated seeds (Table 4.6). The control treatment was observed to be the highest in vigour index for B. vulgaris whereas a low vigour index was noted on P. commune- 2 (Table 4.7). Also, a positive increase in the growth of both the radicle and plumule on S. lycopersicum resulted in high vigour indices (Table 4.8). Table 4. 6:Table showing germination percentages and vigour index of S. oleracea. Treatments Seed Plumule Radicle length Vigour Index germination % length Control 100 25.38 24.70 5008 P. commune1 100 25.88 24.50 5038 P. commune2 100 11.78 11.96 2374 A. fumigatus 83 15.89 15.89 2583.79 P. concavorugulosum1 78 12.39 12.39 1879.8 P. concavorugulosum2 72 11.82 11.82 1661.76 Table 4. 7: Table showing germination percentages and vigour index of B. vulgaris. Treatments Seed germination % Plumule Radicle Vigour length length Index Control 100 14.5 14.05 2855 P. commune1 72 3.34 3.49 491.76 P. commune2 44 2.93 1.43 191.84 A. fumigatus 72 8.95 1.98 786.96 P. concavorugulosum1 83 0.95 8.53 786.84 P. concavorugulosum2 67 13.38 4.44 1193.94 52 Table 4. 8: Table showing germination percentages and vigour index of S. lycopersicum. Treatments Seed Plumule Radicle Vigour Index germination length length % Control 100 25.73 28.53 5426 P. commune1 100 29.83 31.58 6141 P. commune2 100 32.1 34.48 6658 A. fumigatus 89 27.78 28.87 5041.85 P. concavorugulosum1 95 26.15 26.72 5022.65 P. concavorugulosum2 100 29.45 30.11 5956 4.4 DISCUSSION The stimulatory effect of the Penicillium species and A. fumigatus on the germination of S. oleracea (Fig 4.2) and S. lycopersicum (Table 4.8) seeds could have been caused by the exogenous production of plant growth hormones such as auxins, gibberellic acids, abscisic acid, ethylene and jasmonic acid. Many fungal microorganisms have been reported to produce plant hormones that either promote plant growth and development (Leitao and Enguita, 2016; Altaf et al., 2018) or are harmful. Penicillium and Aspergillus species have been reported in various studies to produce gibberellic acid which is needed in the mitotic division of seed germination (Leitao and Enguita, 2016; Ali et al., 2017; Altaf et al., 2018). Plant growth hormones have been reported to control and trigger plant growth and development by promoting cell division, seed germination, stem elongation, etc. (Gupta and Chakrabarty, 2013; Chanclud and Morel, 2016; Wolny et al., 2018). Germination is achieved by positively influencing the production of plant growth hormones that influence the development of radicle and plumule physiological processes (Sanders, 2011; Chanclud and Morel, 2016). This is also evident on S. oleracea seeds for all the treatments, where a statistically significant effect was noted on S. oleracea seed germination (Table 4.1). The control, P. commune-1 and P. commune-2 treatments showed total seed germination (100%) for S. oleracea (Fig 4.2) whereas on the other hand, control, P. commune-1, P. commune-2 and P. concavorugulosum-2 had the highest germination (100%) for S. lycopersicum. This varying germination percentage/rate of S. oleracea and S. lycopersicum seeds could have occurred because of inherent differences in 53 the stimulatory effect of phytohormones produced by the Penicillium and Aspergillus fungi on seed germination. Ali et al. (2017) and Altaf et al. (2018) highlighted the influence of Penicillium species in plant growth promotion and that the effectiveness of the production of secondary metabolites and plant growth-promoting regulators vary under different ecological conditions. This in turn results in different responses by plants growing under different ecological conditions. Since seed germination is a process that is triggered when the embryo undergoes mitotic division which is influenced by the presence or absence of plant growth hormones i.e. abscisic acid (ABA) and gibberellic acids (GA). Abscisic acid is known to inhibit germination whereas gibberellic acids trigger mitotic division in the embryonic cells (Leitao and Enguita, 2016). Control had 100% germination whereas P. concavorugulosum-2, P. concavorugulosum-1 and A. fumigatus showed suppressive effects on S. oleracea (Table 4.6). A similar trend was noted on S. lycopersicum where A. fumigatus and P. concavorugulosum-2 exhibited suppressive effects on seed germination (Table 4.8). Therefore, it can be deduced that the isolates either suppressed production of gibberellic acids or stimulated production of abscisic acid which has a negative effect on seed germination. Similarly, the effect of the isolates on B. vulgaris seemed to be more severe as suppressive effects were noted for all isolates. The seed germination was more severely suppressed in seeds treated with P. commune-2 (44% germination) whereas the control treatment exhibited a total germination rate (100%) compared to the other treatments, albeit at a slower rate (Table 4.7). This could be because there were no antagonistic factors that could have affected or reduced response to water uptake to initiate the germination process in the B. vulgaris control treatment. The slow germination rate could, however, be because of inherent factors in beet seeds that play a role in reduced seed germination rate. For example, a study by Taylor et al. (2003) explained that factors such as mucilaginous layer in beet seeds can lower and suppress germination when layers are too thick and when antagonists such as fungal microorganisms are present. Possibly, this could have resulted in the slow germination rate for other treatments that had introduced fungal isolates and not the control treatment. Furthermore, the high nitrate content of B. vulgaris seeds have been reported to suppress germination by the effect of ammonia that is generated during the nitrification process (Habib, 2010). A few fungal species such as Penicillium and Aspergillus wentii species have been reported to be involved in the nitrification process (Hayatsu et al., 2008). Therefore, this could have contributed to the suppression of seed germination on P. commune-2 and P. concavorugulosum-2 treated seeds. It is also possible that some of the Penicillium species used 54 in the study may be ammonia sensitive fungi, i.e. could be suppressed by high amounts of ammonia or other nitrogenous materials. These ammonia-sensitive fungal species are generally described as a chemo-ecological group of fungi (Barua et al., 2012; Suzuki, 2017). This could have resulted in a decreased germination because of the limited production of plant growth hormones due to antagonistic interaction between the Penicillium species and ammonia bacteria on B. vulgaris seeds (Habib, 2010). On the other hand, the poor seed germination in B. vulgaris that is inoculated with different fungal isolates could be because of poor nutrient uptake by the germinating seed occurring because of competition for nutrients between microbes that had been introduced around the rough seed coat. A study by Mancini and Romanazzi, (2014) on microbial inoculation of seeds for improved crop growth showed that rough seed coats can impair nutrient uptake as well as extrolites penetration while promoting fungal or microbial penetration in germinating seeds. As germination is a physiological process that happens in the cotyledon and embryo, followed by the next stage i.e. elongation of both the radicle and the plumule, the factors that influenced germination would be expected to also influence the post-germination growth processes. A positive and statistically significant effect of P. commune-1, A. fumigatus, and control treatments on radicle and plumule growth was noted for S. oleracea on [Fig 4.4(a) and Fig 4.4(b)]. This could have been because of gibberellins and metabolites producing Penicillium species. Penicillium species have been reported and noted to produce plant hormones and growth-promoting compounds (Altaf et al., 2018). A study conducted by Waqas et al. (2015) reported on gibberellins producing Penicillium species that aid in the promotion as well as an acceleration of growth on plants. These plant growth regulators are known for their role in plant physiological processes such as cell division and elongation, shoot growth stimulation, as well as stem elongation (Gray, 2004; Gupta and Chakrabarty, 2013). A positive response in root and shoot length for S. lycopersicum was noted on seeds treated with P. commune-1, P. commune-2, P. concavorugulosum-2 and the control (Table 4.8). It is noted that this fungal-seed interaction positively influenced seed germination also influenced radicle and plumule growth by accelerating length and improving vigour of the radicle and plumule growth of S. oleracea and S. lycopersicum. Similarly, B. vulgaris radicle growth rate was higher on the control and P. concavorugulosum-2 inoculated seeds compared to P. commune-1, P. commune-2, A. fumigatus and P. concavorugulosum-1 [Fig 4.5 (a) & 4.5(b)]. 55 As elongation of the radicle and plumule determine growth and establishment of seedlings, seed vigour was therefore computed to determine the influence that various Penicillium and Aspergillus treatments had on the vigour of seedlings during the establishment. The high seed vigour index established in S. oleracea and S. lycopersicum seeds for all the treatments was therefore expected. This is indicative of the high potential for good seedling establishment (Table 4.6 and Table 4.8). A higher seed vigour index indicates a vigorous seed lot whereas a lower seed vigour index indicates a weak seed lot that would lead to a poor seedling establishment (Chen et al., 2015). B. vulgaris had the lowest seed vigour index (Table 4.7) on all Penicillium, and Aspergillus treated seeds when compared to S. oleracea and S. lycopersicum (Tables 4.6 and 4.8). On the other hand, control (non-treated) B. vulgaris seeds showed high seed vigour index. The low/reduced vigour index for the other treatments on B. vulgaris might have resulted from the slow response to the Penicillium treatments or the pathogenic influence that the species had on germination as well as plumule and radicle growth [Fig 4.7 (a) and 4.7(b)]. B. vulgaris high seed vigour index on control could have been because there were no antagonistic influences on the seeds during germination as well as radicle and plumule elongation. This could also mean that the inherent beet seed factors that reduce germination had no extreme effect on the control treatment than other treatments as there was no competition for oxygen and nutrients by the naturally occurring microbial load on the untreated seed coats and the germinating beet seeds, which probably occurred on seeds with introduced fungal isolates. The antagonistic effect on B. vulgaris seeds treated with different test isolates could have occurred because of the presence of seed-borne or seed contaminants which acting together with the introduced fungi used in seed coating could have drained the seeds of nutrients. This could have affected its source of nutrients to support the development and growth of radicle and plumule [Fig 4.4(a) and 4.4(b)]. Hamim et al., (2014) reported similar studies which established that suppressive effect on seed germination occurred because the interaction between different microorganism on the seed coat depleted nutrients before germination. The presence of the seed-borne or seed contaminants that were isolated from B. vulgaris could explain the poor seed vigour of B. vulgaris. Hypocotyl lesions were also noted on the control treatment seedlings. This could mean either the pathogenic species were seed-borne or seed contaminants [Fig 4.7(a)]. This infection did not, however, seem to affect the seedling vigour for the control. The severity of the infection was high on seeds treated with A. fumigatus than the other treatments. This could mean that A. fumigatus has pathogenic properties on B. 56 vulgaris. It has been reported that A. fumigatus does produce gliotoxin. This is a mycotoxin that is reportedly known to have different potential suppressive effects on plant growth and to possibly cause a variety of immunosuppressive effects on human health (Smith et al., 2016). Phyto- pathological effect of these fungal isolates should be investigated. Findings of this study that exhibited slight positive responses on germination and seedling growth on S. oleracea and S. lycopersicum demonstrated the potential use of P. concavorugulosum-2 and A. fumigatus as seed inoculants for stimulatory growth of S. oleracea and S. lycopersicum seedlings. There could also be a possibility of endophytic properties by these test isolates, particularly P. commune-1, P. concavorugulosum-2, and A. fumigatus. Fungal endophytes may be explained as microorganisms that can inhabit plant tissues, aiding in plant development and disease defensiveness without exerting negative effects on the plant (Ali et al., 2017; Khiralla et al., 2017; Rana et al., 2019). For example, Waqas et al. (2015) reported on Penicillium and Aspergillus species viz. P. citrinum and A. terreus, which aid and promote plant growth characteristics. It can therefore be deduced that P. commune-1, P. concavorugulosum-2 and A. fumigatus had some endophytic elements. The use of these plant growth enhancers could help promote the establishment of good seedling stands. A lower response was however noted on B. vulgaris. It is therefore recommended that further investigations assessing the effect of the two fungal species is investigated for their endophytic properties. Considering that A. fumigatus has been reported for its immunosuppressive diseases such as Aspergillosis on human health (Smith et al., 2016), this fungal isolate should be excluded for further research work. P. concavorugulosum-2 was therefore selected as a potential test bio-control agent for further research. This test fungal isolate exhibited minimum negative effects on germination and showed positive effects on germination, radicle and plumule growth of the selected vegetables. P. concavorugulosum-2 also showed antibiosis and mycoparasitic properties against F. oxysporum (Chapter 3 in this dissertation), indicating suppressive effects against F. oxysporum. The fungi could therefore be used in combination with Penicillium species such as P. commune-1 and P. concavorugulosum-1 that have a stimulatory effect on plant growth but no suppressive effects on F. oxysporum. 57 CHAPTER FIVE In- vivo analysis of the suppressive effect of P. concavorugulosum2 on F. oxysporum f.sp. radicis lycopersici (FORL) in tomato (Solanum lycopersicum) seedlings under different soil amendments 5.1 INTRODUCTION The success of Fusarium species is influenced by its inherent biological properties and the way they interact with the root rhizosphere and the surrounding soil environment (Abdel-Azeem et al., 2019). These environmental factors include divergent biotic and abiotic factors in different agro-ecological regions. For instance, Fusarium species have inherent properties of long persistence in the soil and they are adapted to attack a wide range of hosts (Leslie and Summerell, 2006, Abdel-Azeem et al., 2019). These adaptive properties make it difficult to manage them. The occurrence of different strains under varying environmental conditions directly or indirectly affect plant root rhizosphere and thereby influencing pathogen infection processes (Validov et al., 2011). This, therefore, influences disease development and exacerbates the disease situation (Elmer, 2015). Furthermore, the use of resistant host or cultivars is slowly being compromised as Fusarium pathogens develop new strains that can overcome host resistance (Andersen et al., 2018; Hermida-Montero et al., 2019). This is reported to be achieved by the F. oxysporum bio-pathotypes that break plant defense mechanisms by use of extrolites to disarm host plants, or by developing multiple infection levels whereby two or more pathogens release competitive exudates that affect the normal functioning of a plant, reducing its ability to defend itself (Abdullah et al., 2017). To mediate the impact of soil-borne pathogens on plants, use of organic amendments and biological control agents were initiated. For example, studies by Matsubara et al., (2002) and Elmer and Pignatello, (2011) analysed the influence and interaction of biochar, mycorrhizae, F. oxysporum and F. proliferatum on asparagus. The studies showed that plants grown on biochar and mycorrhizae amended soils had more pathogen resistance than plants grown on unamended soils (Wiednera et al., 2013). This study was therefore carried out to assess the effects of biochar and mycorrhizae amended soil rhizosphere on the suppressive effect of P. concavorugulosum-2 on the infection process of F. oxysporum f.sp. radicis lycopersici (FORL). 58 5.1.1 Specific objectives (i) To evaluate suppressive effects of P. concavorugulosum-2 on F. oxysporum f.sp. radicis lycopersici (FORL), and the establishment and growth of S. lycopersicum seedlings. (ii) To evaluate effects of mycorrhizae as a rhizosphere amendment on the suppressive effects of P. concavorugulosum-2 on F. oxysporum f.sp. radicis lycopersici (FORL), and the establishment and growth of S. lycopersicum seedlings. (iii)To evaluate effects of biochar as a rhizosphere amendment on the suppressive effects of P. concavorugulosum-2 (MK841454.1) on F. oxysporum f.sp. radicis lycopersici (FORL), and the establishment of S. lycopersicum seedlings. 5.2 MATERIALS AND METHODS 5.2.1 Soil collection and experimental site description The soil was sampled at North-West University Mafikeng Campus Agricultural Research fields (25º 48’ S, 45º 38’ E; 1012 m.a.s.l). The sampled soil was of the Hutton soil type as classified by the soil classification handbook. The study was carried out at North-West University Agricultural farm under a temperature-controlled glasshouse with temperatures ranging between 26℃-32℃. 5.2.2 Laboratory analysis description a. Soil sterilization and preparation Batches of thirty (30) five-kilogram plastic bags of soil were autoclaved for thirty minutes at 121℃ under the pressure of 140 kPa to eliminate microbial population and spores that might alter the objectives of the study. The autoclaved soil was cooled and stored in the laboratory in hessian bags for later use. b. Soil analysis A 100g of soil was sub-sampled and used to carry out pH and texture analysis. Soil pH was determined by use of a standard pH method of analysis. A ratio of 1:5 (soil: water) suspension as described by Rayment and Higginson (1992) was used. Soil texture was analysed using the Bouyoucos hydrometer test as described by Van Reeuwijk (2002). The availability or presence 59 of pathogenic microorganisms was analyzed using the serial dilution method (Sarker et al., 2006). Soil Texture Soil pH • Silt (%) 11.3 6.6 • Clay (%) 25.6 • Sandy (%) 63 c. Mycorrhizae and biochar inoculum preparation Vesicular–arbuscular mycorrhizae (VAM) and hardwood biochar were used as soil amendments in the study. VAM inoculum containing a combination of the following species: Rhizophugus clarus, Gigaspora gigante, Claroideoglomus etunicatum and Paraglomu occulum was used. A portion of the autoclaved soil was apportioned into two equal quantities (thirty kilograms per quantity) and amended with 200g of hardwood biochar for the respective portions. Soil amendment with biochar was carried out by mixing with the soil before sowing. Mycorrhizae inoculation was undertaken at planting. Three 20g portions of the mycorrhizae were placed at 5mm below seeds during planting to enable early mycelial contact with seed radicle. 5.3 Experimental description and design 5.3.1 Experimental description In-vivo analysis of the effectiveness of P. concavorugulosum-2 as a bio-control agent against F. oxysporum f.sp. radicis lycopersici (FORL) on S. lycopersicum was evaluated under different root rhizosphere amendments. a. Seed treatment/rhizosphere amendment Seed inoculation with P. concavorugulosum-2 was applied in a form of a slurry. The slurry was prepared by mixing a 10 g sub-sample of P. concavorugulosum-2 mycelia with 5 g of talc powder. A total of 20 ml sterile water was poured into the mixture and stirred until a homogenous mixture was achieved. 60 The experiment was laid out in a temperature-controlled glasshouse. Experimental treatments were as follows: (i) Un-amended rhizosphere + untreated seeds (T0), (ii) Un-amended rhizosphere + untreated seeds + F. oxysporum f.sp. radicis lycopersici (FORL) inoculation (T1), (iii) Un-amended rhizosphere + P. concavorugulosum2 treated seeds (T2), (iv) P. concavorugulosum2 treated seeds + mycorrhizae amended soil (T3), (v) P. concavorugulosum2 treated seeds + biochar amended soil (T4), (vi) P. concavorugulosum2 treated seeds +Mycorrhizae + Biochar amended soil (T5). Seeds that had been subjected to three respective treatments were directly sown at a depth of about 20 mm in 140 mm polythene pots. Three 20 g portions of the mycorrhizae were placed at 5 mm below seeds during planting to enable early mycelial contact with seed radicle. The treatments were replicated ten times (10) making a total of sixty (60) experimental units. The treatments were laid out in a completely randomized design (CRD) in a temperature-controlled glasshouse with temperatures ranging between 20℃ to 24℃. Seedlings grown in the five respective treatments i.e. T1, T2, T3, T4 and T5 were challenged with F. oxysporum. Inoculations with the pathogenic F. oxysporum f.sp. radicis lycopersici (FORL) inocula were carried out by use of a syringe, 7.5ml of the spore suspension was administered per pot. Inoculation was carried out a week after germination of seedlings for all the treatments i.e., T1, T2, T3, T4 and T5. Experimental units were irrigated with 500 ml of water when necessary to meet their moisture requirements. Weeding was carried out by hand whenever necessary. 5.3.2 Data collection Seedling emergence assessment was carried out at a two-day interval, starting fifteen (15) days after planting until no new seedling emergence was recorded in any of the experimental units. Data collection on plant height, number of leaves and chlorophyll content (CCI) was carried out at one (1) week interval for seven (7) weeks, starting three weeks after full emergence i.e. one week after inoculation with F. oxysporum. Chlorophyll content readings were taken on an individually tagged single leaf by use of a CCM – 200 plus chlorophyll meter. Daily temperatures were recorded during the period of the study. Plant height was measured by use of a measuring tape; the number of leaves was manually counted per seedling. Seedling mortality was recorded at one-week intervals. Occurrence and severity of disease development were assessed at the end of the experiment scoring for root rots and lesions. 61 Total fresh shoot and root biomass of the individual experimental units was determined using the Symmetry PR Precision scale at the end of the experiment. Total root and shoot dry biomass were assessed for the respective experimental units after 72 hours of oven drying at 60℃. 5.4 Mycorrhizae colonization analysis Evaluation for the success of mycorrhizal fungi root colonization was carried out by microscopic examination of the Trypan blue stained roots. Staining was carried out to detect the presence of special structures such as arbuscules and vesicles (Dodd et al., 2000; Vierheilig et al., 2005). 5.5 Statistical analysis Data of the assessed growth parameters i.e., seedling emergence, seedling height, number of leaves, chlorophyll content and total shoots and roots biomass was subjected to analysis of variances using GENSTAT software seventeenth edition (Copy right 2014, VSN International Ltd.). 5.6 RESULTS Among all the parameters investigated i.e. seedling emergence, the number of leaves, seedling height, chlorophyll content and biomass, the effect of different treatments was only significant on seedling dry biomass. 5.6.1 Effect of treatments on seedling biomass. Analysis of variance (ANOVA) showed that the effect of treatments was statistically significant on seedling dry biomass (p<.005) [ Table 5.1]. Table 5. 1: ANOVA showing the effect of treatments on seedling dry biomass. Source of variation d.f. s.s. m.s. v.r. F.pr Treatment 5 1.37831 0.27566 4.24 0.003 Residual 54 3.51271 0.06505 Total 59 4.89102 62 Table 5. 2: Treatment means comparison of seedling dry biomass Treatment Means T0 a0.1660 T5 ab0.3610 T1 ab0.3810 T3 ab0.4210 T4 ab0.4660 T2 b0.6780 T2 - Seeds treated with P. concavorugulosum-2, challenged with F. oxysporum f.sp. radicis lycopersici (FORL) produced a statistically higher dry biomass than T0 - 0control. No statistically significant effect was noted on the following treatments; T5 – Treated seeds + mycorrhizae and biochar amended rhizosphere, T1 – Untreated seeds +unamended rhizosphere, T3 - Treated seeds + mycorrhizae amended rhizosphere, and T4 - Treated seed + biochar amended rhizosphere (Table 5.2). The effect of treatments on seedling biomass is graphically presented in Fig 5.1. 0,9 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0 T0 T1 T2 T3 T4 T5 Treatments 63 Dry biomass (g plant-1) Figure 5.1: Effect of different soil rhizosphere conditions on S. lycopersicum seedlings dry biomass. T0 = Un-amended rhizosphere + untreated seeds, T1 = Un-amended rhizosphere + untreated seeds + Fusarium inoculation, T2 = Un-amended rhizosphere + P. concavorugulosum2 treated seeds, T3 = P. concavorugulosum2 treated seeds + mycorrhizae amended soil, T4 = P. concavorugulosum2 treated seeds + biochar amended soil, T5 = P. concavorugulosum2 treated seeds +Mycorrhizae + Biochar amended soil (T5). 5.6.2 F. oxysporum f.sp. radicis lycopersici (FORL) infection assessment Evidence of crown/stem rot, lower leaf necrosis and root lesions/necrosis were noted on six (6) seedlings that were grown on T4 - Treated seeds + biochar amended rhizosphere seedlings that were inoculated with F. oxysporum f.sp. radicis lycopersici (FORL). Infection percentage was calculated using the number of seedlings showing crown rots, lower leaf necrosis and symptoms of damping off. Number of infected seedlings Infection percentage (%) = × 100 Total number of seedlings 6 = × 100 10 = 60% A total of 60% of the seedlings grown on T4 showed F. oxysporum infection symptoms where crown rots and lower leaf necrosis and discoloration were noted (Fig 5.2). Leaf necrosis Crown rot Root rot 64 Crown/stem rot Root lesion Figure 5. 2: Stem/crown rots, root rots, lesions and leaf necrosis S. lycopersicum seedlings. Seedlings subjected to T0 = Un-amended rhizosphere + untreated seeds are shown in Fig 5.3 to highlight and compare symptom occurrence related to F. oxysporum f.sp. radicis lycopersici (FORL). Figure 5. 3: Seedlings grown in the control treatment. 65 5.6.3 Mycorrhizal root colonization Root samples from T3 and T5 which had mycorrhizal inoculation were evaluated for mycorrhizal colonization. Special features such as arbuscules and vesicles were noted on the root samples from both treatments. Figure 5.3 shows mycorrhizal colonization in S. lycopersicum seedling roots. A B C Figure 5. 4: Mycorrhizal colonization on T3 and T5 S. lycopersicum seedling roots. (A) Vesicles, (B) Root, (C) Arbuscules. 66 5.7 DISCUSSION Seedlings that were inoculated with P. concavorugulosum-2 and challenged with F. oxysporum (T2) had significantly higher biomass than the control (T0). There was however no significant difference with other treatments (T1. T3, T4 and T5). This could be explained by the possible effect of biochar on fungal growth. Biochar as a carbon source can stimulate fungal growth and multiplication (Wiednera et al., 2013). F. oxysporum f.sp. radicis lycopersici (FORL) could have therefore accessed and utilized nutrients faster than P. concavorugulosum-2, increasing its establishment which is evident in T4 (Fig 5.2) where Fusarium infection signs were noted. Treatments T4 and T5’s lower biomass than T2 could have occurred due to the suppressive effect of carbon on the properties of P. concavorugulosum-2. High levels of carbon and excessive addition of carbon in the soil have been reported to, at times, have an inhibitory effect on the growth and colonization of Penicillium species (Costa and Nahas, 2012). Other than biochar being contributory to the suppression of P. concavorugulosum-2, the Penicillium could also have experienced a suppression by the highly competitive growth of mycorrhizae. Mycorrhizae have been noted to have some competitive effect on certain fungal species when grown together at their earliest stages of seedling growth. Mycorrhizal fungi are reported to normally compete with the host or microorganisms around the host during the early stages of their establishment (Dar and Reshi, 2017). In this aspect, the only microorganism which was present was P. concavorugulosum-2 as a seed treatment. Therefore, mycorrhizae could have competed with P. concavorugulosum-2, thus the expected positive effect of P. concavorugulosum-2 could have been compromised. Ingham and Molina (1991); Wehner et al. (2010) and Dar and Reshi (2017) reported on the excessive competitiveness of arbuscular mycorrhizae during its establishment and colonization in an environment with competing microorganisms. Vesicular-Arbuscular mycorrhizal (VAM) fungal colonization on host plant roots is known to trigger and signal plant defense mechanisms. However, these defense responses have been reported to improve mycorrhizal colonization while straining plant growth and development (Gadkar et al., 2001; Evelin et al., 2009). This could also have possibly compromised early seedling growth parameters such as leaf number and shoot height. Considering the suppressive effects on the early seedling establishment of both amendments i.e. high levels of carbon and mycorrhizal competitiveness, it is also therefore possible that the combination of biochar and mycorrhizae (T5) would equally have a cumulative effect on the suppression of P. concavorugulosum-2. 67 The unexpected results i.e. non-significant effect of treatments on the seedling growth parameters, could be because the effect of these treatments had not been realized in the early growth stages of seedlings growth. This would probably be the stage when the mycorrhizae effect would have exerted a negative effect on its host. Although there was successful mycorrhizal infection/colonization (Fig 5.3), unexpected mycorrhizal effects with depressed growth of early vegetative parameters were noted. This is reported in several mycorrhizae research studies. Growth is reportedly known to be eventually compensated at a later growth stage after colonization and establishment (Machineski et al., 2018; Pinheiro et al., 2019; de Sousa Cruz et al., 2020). The significant positive effect on the biomass could be explained by skewed photosynthetic partition in favour of stem and branch thickness. This, however, needs to be investigated Although there was evidence of a significant difference of the independently applied P. concavorugulosum-2 over the control, it could be indicative that P. concavorugulosum-2 is better acting on its own than in combination with other soil amendments. This, however, is inconclusive as there was no significant difference in other growth parameters, viz. the number of leaves, plant height and chlorophyll content. This could be due to the aspect of the delayed expression of mycorrhizal benefit as mycorrhizal symbiosis is influenced by both soil and environmental factors that either aid in the improvement or delay infection and plant growth (Jamiołkowska et al., 2019). Since successful colonization was established (Fig 5.3), the aspect of lack of significant difference on chlorophyll content, plant height and number of leaves could have been due to early harvesting and early termination of the study. That is before mycorrhizae could physiologically express their effects. P. concavorugulosum-2 showed stronger effects when inoculated on its own than in combination with biochar or mycorrhizae. The study however cannot conclusively recommend it as an appropriate biocontrol for F. oxysporum f.sp. lycopersici (FOL) or other soil-borne pathogens. There is therefore a need for further studies to investigate various levels of biochar and mycorrhizae inoculations. This proposed study should particularly investigate the long- term growth responses of various vegetables under different biochar and mycorrhizae treatments. Furthermore, P. concavorugulosum-2 should be subjected to in-vivo tests in unsterilized conditions to evaluate its response when in the presence of other microorganisms that would presumably minimize the suppressive effect of high carbon levels on the artificially inoculated agent i.e. P. concavorugulosum-2. 68 The remarkable performance by P. concavorugulosum-2 (T2) inoculated independently could be explained in two ways : (i) a possibility that P. concavorugulosum-2 eliminated F. oxysporum while promoting seedling growth, (ii) P. concavorugulosum-2 produced plant growth-promoting hormones as evidenced in Chapter 4 paragraph 1. This difference could have influenced the seedling stem growth as there was no significant difference on the other growth parameters other than seedling biomass. It seems that the effect of P. concavorugulosum-2 was more focused on the enhancement of stem thickness and branching, which could have influenced increasing the seedling biomass. This possibility could be explained from the results of studies by Chanclud and Morel (2016) who established that Penicillium species produced phytohormones such as cytokinin, auxins and gibberellic acids. These plant growth hormones would have been responsible for the promotion of seedling branches, stem growth and elongation (cell division). These parameters which were found to be non-significant would therefore need to be re-evaluated or assessed in in-vivo studies where long-term effects of the treatments should be investigated. 69 CHAPTER SIX 6.1 General discussion and conclusion In the search for a bio-control agent for the management of F. oxysporum f.sp. radicis lycopersici (FORL) and other soil-borne pathogens that are well adapted to dry hot semi-arid regions, several experiments were carried out. This included isolation of fungal species from different soils in semi-arid regions and evaluated them for their suppressive effect against F. oxysporum f.sp. radicis lycopersici (FORL). These isolated fungal isolates were also evaluated for their phytopathological biosafety for commonly grown vegetables. These fungal species were initially identified by the use of visual and microscopical examination of morphological characteristics. Morphological identification resulted in the identification of all fungal species to the genus level. These were later identified by DNA molecular technology. The molecular identification procedure enabled the achievement of more accurate identification of isolate A. fumigatus which had initially been morphologically misidentified as Penicillium species. Through molecular identification technology, the test fungi were therefore conclusively identified to be the following species: P. commune-1, P. commune-2, A. fumigatus, P. concavorugulosum-1 and P. concavorugulosum-2. The identified fungal isolates were evaluated for suppressive properties against F. oxysporum f.sp. radicis lycopersici (FORL). The study revealed a diversity of inherent biological properties between the different isolates. P. concavorugulosum-2 exhibited a multiplicity of superior suppressive properties that included antibiosis, growth competitiveness and mycoparasitism. The second most suppressive isolate was A. fumigatus with similar properties. The other fungal isolates such as P. commune-1, P. commune-2, P. concavorugulosum-1 did not exhibit worthwhile antagonism against F. oxysporum f.sp. radicis lycopersici (FORL). F. oxysporum appeared to outgrow them. In addition to evaluating their efficacy against F. oxysporum f.sp. radicis lycopersici (FORL), these test fungal isolates were examined for their phytopathological biosafety on selected commonly grown vegetables namely: tomatoes (S. lycopersicum), spinach (S. oleracea) and beetroot (B. vulgaris). These fungal isolates exhibited a diversity of effects that included various degrees of a stimulatory effect on the germination, growth of radicle and plumule of all test vegetables. Out of all the test fungal isolates, four species i.e. A. fumigatus, P. commune- 1, P. commune-2 and P. concavorugulosum-2 showed interesting growth response to all the test vegetables except for B vulgaris. 70 The overall conclusion of the study is that although P. commune-1 and P. commune-2 showed less suppressiveness against F. oxysporum, they had a stimulatory effect on S. oleracea and S. lycopersicum germination, radicle and plumule growth. Therefore, they should be further investigated for their possible contributory function to improve seedling vigour. They could particularly be investigated for their possible synergistic effect on seedling growth enhancement when used in combination with P. concavorugulosum-2. The negative effect of these test fungal isolates on the B. vulgaris needs to be investigated. As P. concavorugulosum-2 exhibited the most biocontrol properties against F. oxysporum f.sp. radicis lycopersici (FORL), it was further subjected to in-vivo evaluation under varying tomato (S. lycopersicum) seedling rhizospheres conditions. The varying rhizosphere conditions included those generated by inoculation with VAM mycorrhizae, and biochar amended conditions. This study generated interesting results as evidenced by the statistically significant response in biomass accumulation for seedlings growing in un-amended conditions (P<0,05). The study, however, revealed the limitation of using sterilized soil conditions. Sterilized soil conditions did not reflect a realistic situation where the biocontrol inocula would compete and interact with a diverse soil microbial population. Furthermore, the short period of the study did not give an indication of the persistence of the introduced inocula and this short period did not also allow assessment for the long term benefits of mycorrhizae particularly for the species that are known to be late colonizers. There is, therefore, need for a long-term study particularly investigating whether there is variation in the effect of these biocontrol measures between the different forms i.e. FORL and FOL. It is also recommended that the effect of these measures on the endophytic F. oxysporum should be established. 71 REFERENCES Abdel-Azeem, A.M., Abdel-Azeem, M.A., Darwish, A.G., Nafady, N.A. and Ibrahim, N.A., (2019). Fusarium: biodiversity, ecological significances, and industrial applications. In Recent Advancement in White Biotechnology Through Fungi, pp. 201-261. Abdul-Baki, A. A. and Anderson, J. D. J., (1973). Vigor determination in soybean seed by multiple criteria 1. Crop Science, 13(6), pp. 630-63. Abdullah, A. S., Moffat, C. S., Lopez-Ruiz, F. J., Gibberd, M. R., Hamblin, J. and Zerihun, A., (2017). Host–multi-pathogen warfare: pathogen interactions in co-infected plants. Frontiers in plant science, 8, p. 1806. Abellana, M., Sanchis, V. and Ramos, A. J., (2001). Effect of water activity and temperature on growth of three Penicillium species and Aspergillus flavus on a sponge cake analogue. International journal of food microbiology, 71(2-3), pp.151-157. Afshari, M., Shahidi, F., Mortazavi, S. A., Tabatabai, F. and Es' haghi, Z., (2015). Investigating the influence of pH, temperature and agitation speed on yellow pigment production by Penicillium aculeatum ATCC 10409. Natural product research, 29(14), pp. 1300-1306. Agrios, G.N., (2005). Plant pathology 5th Edition: Elsevier Academic Press. Burlington, Ma. USA, pp.79-103. Agudelo-Escobar, L.M., Gutiérrez-López, Y. and Urrego-Restrepo, S., (2017). Effects of aeration, agitation and pH on the production of mycelial biomass and exopolysaccharide from the filamentous fungus Ganoderma lucidum. Dyna, 84(200), pp.72-79. Akköprü, A. and Demir, S., (2005). Biological control of Fusarium wilt in tomato caused by Fusarium oxysporum f. sp. lycopersici by AMF Glomus intraradices and some rhizobacteria. Journal of Phytopathology, 153(9), pp.544-550. Alapont, C., López-Mendoza, M.C., Gil, J.V. and Martínez-Culebras, P.V., (2014). Mycobiota and toxigenic Penicillium species on two Spanish dry-cured ham manufacturing plants. Food Additives & Contaminants: Part A, 31(1), pp.93-104. Ali, S., Charles, T.C. and Glick, B.R., (2017). Endophytic phytohormones and their role in plant growth promotion. In Functional Importance of the Plant Microbiome. pp. 89- 105). Ali, A.S. and Elozeiri, A.A., (2017). Metabolic processes during seed germination. Advances in Seed Biology, pp.141-166 Alkorta, I., Epelde, L. and Garbisu, C., (2017). Environmental parameters altered by climate change affect the activity of soil microorganisms involved in bioremediation. FEMS microbiology letters, 364(19). Alshannaq, A. and Yu, J.H., (2017). Occurrence, toxicity, and analysis of major mycotoxins in food. International journal of environmental research and public health, 14(6), p.632. Altaf, M.M., Imran, M., Abulreesh, H.H., Khan, M.S. and Ahmad, I., (2018). Diversity and applications of Penicillium spp. in plant-growth promotion. In New and Future Developments in Microbial Biotechnology and Bioengineering (pp. 261-276). Amballa, H. and Bhumi, N.R., (2016). Significance of arbuscular mycorrhizal fungi and rhizosphere microflora in plant growth and nutrition. In Plant-Microbe Interaction: An Approach to Sustainable Agriculture (pp. 417-452). Springer, Singapore. Amini, J. and Sidovich, D., (2010). The effects of fungicides on Fusarium oxysporum f. sp. lycopersici associated with Fusarium wilt of tomato. Journal of plant protection research. (50), pp. 172-178. Andersen, E.J., Ali, S., Byamukama, E., Yen, Y. and Nepal, M.P., (2018). Disease resistance mechanisms in plants. Genes, 9(7), pp.339. 72 Bais, H.P., Weir, T.L., Perry, L.G., Gilroy, S. and Vivanco, J.M., (2006). The role of root exudates in rhizosphere interactions with plants and other organisms. Annu. Rev. Plant Biol., 57, pp.233-266. Bareke, T. J. A. P. A. R., (2018). Biology of seed development and germination physiology. (8), pp 336-46. Barua, B.S., Suzuki, A. and Hoang, P.N.D., (2012). Effects of different nitrogen sources on interactions between ammonia fungi and non-ammonia fungi. Mycology, 3(1), pp.36- 53. Bastakoti, S., Belbase, S., Manandhar, S. and Arjyal, C., (2017). Trichoderma species as biocontrol agent against soil borne fungal pathogens. Nepal Journal of Biotechnology, 5(1), pp.39-45. Baysal, Ö., Siragusa, M., Ikten, H., Polat, I., Gümrükcü, E., Yigit, F., Carimi, F. and da Silva, J.T., (2009). Fusarium oxysporum f. sp. lycopersici races and their genetic discrimination by molecular markers in West Mediterranean region of Turkey. Physiological and Molecular Plant Pathology, 74(1), pp.68-75. Bazin, M.J., Markham, P., Scott, E.M. and Lynch, J.M., (1990). Population dynamics and rhizosphere interactions. The rhizosphere., pp.99-127. Bechem, E.T. and Afanga, Y.A., (2017). Morphological and molecular identification of fungi associated with corm rot and blight symptoms on plantain (Musa paradisiaca) in macro- propagators. International Journal of Biological and Chemical Sciences, 11(6), pp.2793-2808. Berruti, A., Lumini, E., Balestrini, R. and Bianciotto, V., (2016). Arbuscular mycorrhizal fungi as natural biofertilizers: let's benefit from past successes. Frontiers in microbiology, (6), pp.1559. Bhatnagar, D., Yu, J. and Ehrlich, K.C., (2002). Toxins of filamentous fungi. Chemical immunology, (81), pp.167-206. Bonanomi, G., Antignani, V., Capodilupo, M. and Scala, F., (2010). Identifying the characteristics of organic soil amendments that suppress soil-borne plant diseases. Soil Biology and Biochemistry, 42(2), pp.136-144. Bonilla, N., Gutiérrez-Barranquero, J.A., Vicente, A.D. and Cazorla, F.M., (2012). Enhancing soil quality and plant health through suppressive organic amendments. Diversity, 4(4), pp.475-491. Bräse, S., Encinas, A., Keck, J. and Nising, C.F., (2009). Chemistry and biology of mycotoxins and related fungal metabolites. Chemical reviews, 109(9), pp.3903-3990. Brito, I., Carvalho, M. and Goss, M.J., (2013). Soil and weed management for enhancing arbuscular mycorrhiza colonization of wheat. Soil use and management, 29(4), pp.540- 546. Brunner, K., Zeilinger, S., Ciliento, R., Woo, S.L., Lorito, M., Kubicek, C.P. and Mach, R.L., (2005). Improvement of the fungal biocontrol agent Trichoderma atroviride to enhance both antagonism and induction of plant systemic disease resistance. Applied and environmental microbiology, 71(7), pp.3959-3965. Bulgari, D., Fiorini, L., Gianoncelli, A., Bertuzzi, M. and Gobbi, E., (2020). Enlightening Gliotoxin Biological System in Agriculturally Relevant Trichoderma spp. Frontiers in Microbiology, 11, pp.200. Cardoso, P.G., Queiroz, M.V.D., Pereira, O.L. and Araújo, E.F.D., (2007). Morphological and molecular differentiation of the pectinase producing fungi Penicillium expansum and Penicillium griseoroseum. Brazilian Journal of Microbiology, 38(1), pp.71-77. Castillo, A.G., Puig, C.G. and Cumagun, C.J.R., (2019). Non-synergistic effect of Trichoderma harzianum and Glomus spp. in reducing infection of Fusarium wilt in banana. Pathogens, 8(2), p.43. 73 Chakraborty, S. and Newton, A.C., (2011). Climate change, plant diseases and food security: an overview. Plant pathology, 60(1), pp.2-14. Chanclud, E. and Morel, J.B., (2016). Plant hormones: a fungal point of view. Molecular plant pathology, 17(8), pp.1289-1297. Chatterjee, S., Kuang, Y., Splivallo, R., Chatterjee, P. and Karlovsky, P., (2016). Interactions among filamentous fungi Aspergillus niger, Fusarium verticillioides and Clonostachys rosea: fungal biomass, diversity of secreted metabolites and fumonisin production. BMC microbiology, 16(1), pp.83. Chen, C., Jiang, Q., Ziska, L.H., Zhu, J., Liu, G., Zhang, J., Ni, K., Seneweera, S. and Zhu, C., (2015). Seed vigor of contrasting rice cultivars in response to elevated carbon dioxide. Field Crops Research, 178, pp.63-68. Christie, P., Li, X. and Chen, B., (2004). Arbuscular mycorrhiza can depress translocation of zinc to shoots of host plants in soils moderately polluted with zinc. Plant and Soil, 261(1-2), pp.209-217. Costa, B.D.O. and Nahas, E., (2012). Growth and enzymatic responses of phytopathogenic fungi to glucose in culture media and soil. Brazilian Journal of Microbiology, 43(1), pp.332-340. da Silva, J.C., Suassuna, N.D. and Bettiol, W., (2017). Management of Ramularia leaf spot on cotton using integrated control with genotypes, a fungicide and Trichoderma asperellum. Crop Protection, 94, pp.28-32. Dar, M.H. and Reshi, Z.A., (2017). Vesicular Arbuscular Mycorrhizal (VAM) fungi-as a major biocontrol agent in modern sustainable agriculture system. Russian Agricultural Sciences, 43(2), pp.138-143. Debbi, A., Boureghda, H., Monte, E. and Hermosa, R., (2018). Distribution and genetic variability of Fusarium oxysporum associated with tomato diseases in Algeria and a biocontrol strategy with indigenous Trichoderma spp. Frontiers in microbiology, 9, p.282. De Bon, H., Huat, J., Parrot, L., Sinzogan, A., Martin, T., Malézieux, E. and Vayssières, J.F., (2014). Pesticide risks from fruit and vegetable pest management by small farmers in sub-Saharan Africa. A review. Agronomy for sustainable development, 34(4), pp.723- 736. de Lamo, F.J. and Takken, F.L., (2020). Biocontrol by Fusarium oxysporum using endophyte- mediated resistance. Frontiers in Plant Science, 11. de Sousa Cruz, R., Araújo, F.H.V., França, A.C., Sardinha, L.T. and Machado, C.M.M., (2020). Physiological responses of Coffea arabica cultivars in association with arbuscular mycorrhizal fungi. Demirel, R., Sariozlu, N.Y. and İlhan, S., (2013). Polymerase chain reaction (PCR) identification of terverticillate Penicillium species isolated from agricultural soils in eskişehir province. Brazilian Archives of Biology and Technology, 56(6), pp.980-984. Desjardins, A.E. and Proctor, R.H., (2007). Molecular biology of Fusarium mycotoxins. International journal of food microbiology, 119(1-2), pp.47-50. Diblasi, L., Arrighi, F., Silva, J., Bardón, A. and Cartagena, E., (2015). Penicillium commune metabolic profile as a promising source of antipathogenic natural products. Natural Product Research, 29(23), pp.2181-2187. Dodd, J.C., Boddington, C.L., Rodriguez, A., Gonzalez-Chavez, C. and Mansur, I., (2000). Mycelium of arbuscular mycorrhizal fungi (AMF) from different genera: form, function and detection. Plant and soil, 226(2), pp.131-151. Eijsackers, H., Beneke, P., Maboeta, M., Louw, J.P.E. and Reinecke, A.J., (2005). The implications of copper fungicide usage in vineyards for earthworm activity and 74 resulting sustainable soil quality. Ecotoxicology and Environmental Safety, 62(1), pp.99-111. Elmer, W., (2015). Ecology and management of Fusarium diseases. Crop Protection, 73, pp.1- 107. Evelin, H., Kapoor, R. and Giri, B., (2009). Arbuscular mycorrhizal fungi in alleviation of salt stress: a review. Annals of botany, 104(7), pp.1263-1280. Fravel, D., Olivain, C. and Alabouvette, C., (2003). Fusarium oxysporum and its biocontrol. New phytologist, 157(3), pp.493-502. Frisvad, J.C., Larsen, T.O., De Vries, R., Meijer, M., Houbraken, J., Cabañes, F.J., Ehrlich, K. and Samson, R.A., (2007). Secondary metabolite profiling, growth profiles and other tools for species recognition and important Aspergillus mycotoxins. Studies in Mycology, 59, pp.31-37. Gadkar, V., David-Schwartz, R., Kunik, T. and Kapulnik, Y., (2001). Arbuscular mycorrhizal fungal colonization. Factors involved in host recognition. Plant physiology, 127(4), pp.1493-1499. Giri, B., Kapoor, R. and Mukerji, K.G., (2003). Influence of arbuscular mycorrhizal fungi and salinity on growth, biomass, and mineral nutrition of Acacia auriculiformis. Biology and Fertility of Soils, 38(3), pp.170-175. Gordon, T.R., (2017). Fusarium oxysporum and the Fusarium wilt syndrome. Annual review of phytopathology, 55, pp.23-39. Gray, W.M., (2004). Hormonal regulation of plant growth and development. PLoS Biol, 2(9), p.e311. Green, M.R. and Sambrook, J., (2019). Analysis of DNA by agarose gel electrophoresis. Cold Spring Harbor Protocols, 2019(1), pp.pdb-top100388. Gupta, R. and Chakrabarty, S.K., (2013). Gibberellic acid in plant: still a mystery unresolved. Plant signaling & behavior, 8(9), p.e25504. Habib, M., (2010). Sugarbeet (Beta vulgaris L.) seed pre-treatment with water and HCl to improve germination. African Journal of Biotechnology, 9(9). Hamed, E.R., Awad, H.M., Ghazi, E.A., El-Gamal, N.G. and Shehata, H.S., (2015). Trichoderma asperellum isolated from salinity soil using rice straw waste as biocontrol agent for cowpea plant pathogens. Journal of Applied Pharmaceutical Science, 5(2), pp.091-098. Hamim, I., Mohanto, D.C., Sarker, M.A. and Ali, M.A., (2014). Effect of seed borne pathogens on germination of some vegetable seeds. Journal of Phytopathology and Pest Management, pp.34-51. Hammer, E.C., Forstreuter, M., Rillig, M.C. and Kohler, J., (2015). Biochar increases arbuscular mycorrhizal plant growth enhancement and ameliorates salinity stress. Applied soil ecology, 96, pp.114-121. Hassani, M.A., Durán, P. and Hacquard, S., (2018). Microbial interactions within the plant holobiont. Microbiome, 6(1), p.58. Hayatsu, M., Tago, K. and Saito, M., (2008). Various players in the nitrogen cycle: diversity and functions of the microorganisms involved in nitrification and denitrification. Soil Science and Plant Nutrition, 54(1), pp.33-45. Hayyat, A., Javed, M., Rasheed, I., Ali, S., Shahid, M.J., Rizwan, M., Javed, M.T. and Ali, Q., (2016). Role of Biochar in Remediating Heavy Metals in Soil. In Phytoremediation (pp. 421-437). Heydari, A. and Pessarakli, M., (2010). A review on biological control of fungal plant pathogens using microbial antagonists. Journal of biological sciences, 10(4), pp.273- 290. 75 Himratul-Aznita, W.H., Mohd-Al-Faisal, N. and Fathilah, A.R., (2011). Determination of the percentage inhibition of diameter growth (PIDG) of Piper betle crude aqueous extract against oral Candida species. Journal of Medicinal Plants Research, 5(6), pp.878-884. Hossain, M.K., Strezov, V., Chan, K.Y. and Nelson, P.F., (2010). Agronomic properties of wastewater sludge biochar and bioavailability of metals in production of cherry tomato (Lycopersicon esculentum). Chemosphere, 78(9), pp.1167-1171. Houbraken, J., Frisvad, J.C. and Samson, R.A., (2011). Taxonomy of penicillium section citrina. Studies in mycology, 70, pp.53-138. Huang, X.F., Chaparro, J.M., Reardon, K.F., Zhang, R., Shen, Q. and Vivanco, J.M., (2014). Rhizosphere interactions: root exudates, microbes, and microbial communities. Botany, 92(4), pp.267-275. Husaini, A.M., Sakina, A. and Cambay, S.R., (2018). Host–pathogen interaction in Fusarium oxysporum infections: Where do we stand?. Molecular Plant-Microbe Interactions, 31(9), pp.889-898. Hyde, K.D., Xu, J., Rapior, S., Jeewon, R., Lumyong, S., Niego, A.G.T., Abeywickrama, P.D., Aluthmuhandiram, J.V., Brahamanage, R.S., Brooks, S. and Chaiyasen, A., (2019). The amazing potential of fungi: 50 ways we can exploit fungi industrially. Fungal Diversity, pp.1-136. Igiehon, N.O. and Babalola, O.O., (2017). Biofertilizers and sustainable agriculture: exploring arbuscular mycorrhizal fungi. Applied Microbiology and Biotechnology, 101(12), pp.4871-4881. Ingham, E.R. and Molina, R., (1991). Interactions among mycorrhizal fungi, rhizosphere organisms, and plants. Microbial mediation of plant-herbivore interactions. Wiley, New York, pp.169-197. Ismaiel, A.A. and Papenbrock, J., 2(015). Mycotoxins: producing fungi and mechanisms of phytotoxicity. Agriculture, 5(3), pp.492-537. Jamiołkowska, A., Thanoon, A.H., Patkowska, E. and Grządziel, J., (2019). Impact of AMF Claroideoglomus etunicatum on the structure of fungal communities in the tomato rhizosphere. Acta Mycologica, 54(1). Jan, A., Bhat, K.M., Bhat, S.J.A., Mir, M.A., Bhat, M.A., Imtiyaz, A. and Rather, J.A., (2013). Surface sterilization method for reducing microbial contamination of field grown strawberry explants intended for in vitro culture. African Journal of Biotechnology, 12(39). Jayaraj, R., Megha, P. and Sreedev, P., (2016). Organochlorine pesticides, their toxic effects on living organisms and their fate in the environment. Interdisciplinary toxicology, 9(3- 4), pp.90-100. Johnston, C.L., (2011). Identification of Penicillium species in the South African litchi export chain (Doctoral dissertation, University of Pretoria). Joshi, R., (2018). A review of Fusarium oxysporum on its plant interaction and industrial use. J Med Plant, 6(3), pp.112-115. Kamei, K. and Watanabe, A., (2005). Aspergillus mycotoxins and their effect on the host. Medical mycology, 43(Supplement_1), pp.S95-S99. Kamili, A.N. and Ganai, B.A., (2011). Identification of some Penicillium species by traditional approach of morphological observation and culture. African Journal of Microbiology Research, 5(21), pp.3493-3496. Khiralla, A., Spina, R., Yagi, S., Mohamed, L. and Laurain-Mattar, D., (2016). Endophytic fungi: occurrence, classification, function and natural products. Endophytic fungi: diversity, characterization and biocontrol, pp.1-19. 76 Khokhar, I., Haider, M.S., Mukhtar, I., Ali, A., Mushtaq, S. and Ashfaq, M., (2013). Effect of Penicillium species culture filtrate on seedling growth of wheat. International Research Journal of Agricultural Science and Soil Science, 3(1), pp.24-29. Kim, J.Y., Lee, S.Y. and Choi, H.S., (2013). Molecular and morphological identification of fungal species isolated from rice meju. Food Science and Biotechnology, 22(3), pp.721-728. Knudsen, G.R. and Dandurand, L.M.C., (2014). Ecological complexity and the success of fungal biological control agents. Advances in Agriculture, 2014. Koehler, A.M. and Shew, H.D., (2019). Effects of fungicide applications on root-infecting microorganisms and overwintering survival of perennial stevia. Crop Protection, 120, pp.13-20. Koffi, Y.F., Diguta, C.A.M.E.L.I.A., Alloue-Boraud, M.I.R.E.I.L.L.E., Koffi, L.B., Dje, M., Gherghina, E.V.E.L.I.N.A. and Matei, F., (2019). PCR-ITS-RFLP identification of pineapple spoilage fungi [J]. Rom Biotechnol Lett, 24, pp.418-24. Köhl, J., Kolnaar, R. and Ravensberg, W.J., (2019). Mode of action of microbial biological control agents against plant diseases: relevance beyond efficacy. Frontiers in Plant Science, 10, p.845. Konappa, N., Krishnamurthy, S., Siddaiah, C.N., Ramachandrappa, N.S. and Chowdappa, S., (2018). Evaluation of biological efficacy of Trichoderma asperellum against tomato bacterial wilt caused by Ralstonia solanacearum. Egyptian Journal of Biological Pest Control, 28(1), p.63. Kumar, A., Asthana, M., Gupta, A., Nigam, D. and Mahajan, S., (2018). Secondary metabolism and antimicrobial metabolites of Penicillium. New and Future Developments in Microbial Biotechnology and Bioengineering, pp. 47-68. Kumar, S., Thakur, M. and Rani, A., (2014). Trichoderma: Mass production, formulation, quality control, delivery and its scope in commercialization in India for the management of plant diseases. African Journal of Agricultural Research, 9(53), pp.3838-3852. Künzler, M., (2018). How fungi defend themselves against microbial competitors and animal predators. PLoS pathogens, 14(9), p.e1007184. Larena, I., Melgarejo, P. and De Cal, A., (2003). Drying of conidia of Penicillium oxalicum, a biological control agent against Fusarium wilt of tomato. Journal of Phytopathology, 151(11‐12), pp.600-606. Leitão, A.L. and Enguita, F.J., (2016). Gibberellins in Penicillium strains: challenges for endophyte-plant host interactions under salinity stress. Microbiological research, 183, pp.8-18. Leslie, J.F. and Summerell, B.A., (2006). Fusarium laboratory workshops—a recent history. Mycotoxin Research, 22(2), pp.73-74. Lindenthal, M., Steiner, U., Dehne, H.W. and Oerke, E.C., (2005). Effect of downy mildew development on transpiration of cucumber leaves visualized by digital infrared thermography. Phytopathology, 95(3), pp.233-240. Machineski, G.S., Victola, C.A.G., Honda, C., Machineski, O., de Fátima Guimarães, M. and Balota, E.L., (2018). Effects of arbuscular mycorrhizal fungi on early development of persimmon seedlings. Folia Horticulturae, 30(1), pp.39-46. Magid, J. and Kjærgaard, C., (2001). Recovering decomposing plant residues from the particulate soil organic matter fraction: size versus density separation. Biology and Fertility of Soils, 33(3), pp.252-257. Mancini, V. and Romanazzi, G., (2014). Seed treatments to control seedborne fungal pathogens of vegetable crops. Pest management science, 70(6), pp.860-868. Manzo, D., Ferriello, F., Puopolo, G., Zoina, A., D’Esposito, D., Tardella, L., Ferrarini, A. and Ercolano, M.R., (2016). Fusarium oxysporum f. sp. radicis-lycopersici induces distinct 77 transcriptome reprogramming in resistant and susceptible isogenic tomato lines. BMC plant biology, 16(1), pp.1-14. Martínez-Medina, A., Pascual, J.A., Pérez-Alfocea, F., Albacete, A. and Roldán, A., (2010). Trichoderma harzianum and Glomus intraradices modify the hormone disruption induced by Fusarium oxysporum infection in melon plants. Phytopathology, 100(7), pp.682-688. McGovern, R.J., (2015). Management of tomato diseases caused by Fusarium oxysporum. Crop Protection, 73, pp.78-92. Mendez, A., Pérez, C., Montañéz, J.C., Martínez, G. and Aguilar, C.N., (2011). Red pigment production by Penicillium purpurogenum GH2 is influenced by pH and temperature. Journal of Zhejiang University Science B, 12(12), pp.961-968. Mendoza, J.L.H., Pérez, M.I.S., Prieto, J.M.G., Velásquez, J.D.Q., Olivares, J.G.G. and Langarica, H.R.G., (2015). Antibiosis of Trichoderma spp strains native to northeastern Mexico against the pathogenic fungus Macrophomina phaseolina. Brazilian Journal of Microbiology, 46(4), pp.1093-1101. Michielse, C.B. and Rep, M., (2009). Pathogen profile update: Fusarium oxysporum. Molecular plant pathology, 10(3), p.311. Montesinos-Herrero, C., Smilanick, J.L., Tebbets, J.S., Walse, S. and Palou, L., (2011). Control of citrus postharvest decay by ammonia gas fumigation and its influence on the efficacy of the fungicide imazalil. Postharvest biology and technology, 59(1), pp.85-93. Moore, D., Robson, G.D. and Trinci, A.P., (2020). 21st century guidebook to fungi. Cambridge University Press. Nadeem, S.M., Ahmad, M., Zahir, Z.A., Javaid, A. and Ashraf, M., (2014). The role of mycorrhizae and plant growth promoting rhizobacteria (PGPR) in improving crop productivity under stressful environments. Biotechnology advances, 32(2), pp.429- 448. Naseri, B. and Tabande, L., (2017). Patterns of Fusarium wilt epidemics and bean production determined according to a large-scale dataset from agro-ecosystems. Rhizosphere, 3, pp.100-104. Nguyen, T., Flint, S. and Palmer, J., (2020). Control of aflatoxin M1 in milk by novel methods: A review. Food Chemistry, 311, p.125984. Nieminen, S.M., Kärki, R., Auriola, S., Toivola, M., Laatsch, H., Laatikainen, R., Hyvärinen, A. and von Wright, A., (2002). Isolation and identification of Aspergillus fumigatus mycotoxins on growth medium and some building materials. Applied and environmental microbiology, 68(10), pp.4871-4875. Nirmaladevi, D., Venkataramana, M., Srivastava, R.K., Uppalapati, S.R., Gupta, V.K., Yli- Mattila, T., Tsui, K.C., Srinivas, C., Niranjana, S.R. and Chandra, N.S., (2016). Molecular phylogeny, pathogenicity and toxigenicity of Fusarium oxysporum f. sp. lycopersici. Scientific reports, 6(1), pp.1-14. Oerke, E.C. and Dehne, H.W., (2004). Safeguarding production—losses in major crops and the role of crop protection. Crop protection, 23(4), pp.275-285. Olsen, M., Lindqvist, R., Bakeeva, A., Su-lin, L.L. and Sulyok, M., (2019). Distribution of mycotoxins produced by Penicillium spp. inoculated in apple jam and crème fraiche during chilled storage. International journal of food microbiology, 292, pp.13-20. Oyebanji, O.B., Nweke, O., Odebunmi, O., Galadima, N.B., Idris, M.S., Nnodi, U.N., Afolabi, A.S. and Ogbadu, G.H., (2009). Simple, effective and economical explant-surface sterilization protocol for cowpea, rice and sorghum seeds. African Journal of Biotechnology, 8(20). Panth, M., Hassler, S.C. and Baysal-Gurel, F., (2020). Methods for management of soilborne diseases in crop production. Agriculture, 10(1), p.16. 78 Park, M.S., Oh, S.Y., Fong, J.J., Houbraken, J. and Lim, Y.W., 2019. The diversity and ecological roles of Penicillium in intertidal zones. Scientific reports, 9(1), pp.1-11. Paymaneh, Z., Gryndler, M., Konvalinková, T., Benada, O., Borovička, J., Bukovská, P., Püschel, D., Řezáčová, V., Sarcheshmehpour, M. and Jansa, J., (2018). Soil matrix determines the outcome of interaction between mycorrhizal symbiosis and biochar for Andropogon gerardii growth and nutrition. Frontiers in Microbiology, 9, p.2862. Perincherry, L., Lalak-Kańczugowska, J. and Stępień, L., (2019). Fusarium-Produced mycotoxins in plant-pathogen interactions. Toxins, 11(11), p.664. Perotto, S., Angelini, P., Bianciotto, V., Bonfante, P., Girlanda, M., Kull, T., Mello, A., Pecoraro, L., Perini, C., Persiani, A.M. and Saitta, A., (2013). Interactions of fungi with other organisms. Plant Biosystems-An International Journal Dealing with all Aspects of Plant Biology, 147(1), pp.208-218. Perrone, G. and Susca, A., (2017). Penicillium species and their associated mycotoxins. Mycotoxigenic Fungi (pp. 107-119). Peterson, S.W., (2012). Aspergillus and Penicillium identification using DNA sequences: barcode or MLST?. Applied microbiology and biotechnology, 95(2), pp.339-344. Pietro, A.D., Madrid, M.P., Caracuel, Z., Delgado‐Jarana, J. and Roncero, M.I.G., (2003). Fusarium oxysporum: exploring the molecular arsenal of a vascular wilt fungus. Molecular plant pathology, 4(5), pp.315-325. Pinheiro, E.M., Nobre, C.P., Costa, T.V., Tavares, O.C.H. and Araujo, J.R.G., (2019). Arbuscular mycorrhizal fungi in seedling formation of Barbados Cherry (Malpighia emarginata DC). Revista Caatinga, 32(2), pp.370-380. Pitt, J.I., (2002). Biology and ecology of toxigenic Penicillium species. In Mycotoxins and food safety (pp. 29-41). Springer, Boston, MA. Pitt, J.I., (2006). Fungal ecology and the occurrence of mycotoxins. Mycotoxins and phycotoxins: advances in determination, toxicology and exposure management. Wageningen, Netherlands, Wageningen Academic Publishers, pp.33-42. Popovski, S. and Celar, F.A., (2013). The impact of environmental factors on the infection of cereals with Fusarium species and mycotoxin production-a review/Vpliv okoljskih dejavnikov na okuzbo zit z glivami Fusarium spp. in tvorbo mikotoksinov-pregledni clanek. Acta Agriculturae Slovenica, 101(1), p.105. Qualhato, T.F., Lopes, F.A.C., Steindorff, A.S., Brandao, R.S., Jesuino, R.S.A. and Ulhoa, C.J., (2013). Mycoparasitism studies of Trichoderma species against three phytopathogenic fungi: evaluation of antagonism and hydrolytic enzyme production. Biotechnology letters, 35(9), pp.1461-1468. Rabha, J. and Jha, D.K., (2018). Metabolic diversity of penicillium. In New and Future Developments in Microbial Biotechnology and Bioengineering (pp. 217-234).. Raja, H.A., Miller, A.N., Pearce, C.J. and Oberlies, N.H., (2017). Fungal identification using molecular tools: a primer for the natural products research community. Journal of natural products, 80(3), pp.756-770. Rana, A., Sahgal, M. and Johri, B.N., (2017). Fusarium oxysporum: genomics, diversity and plant–host interaction. Developments in Fungal Biology and Applied Mycology (pp. 159-199). Rana, K.L., Kour, D., Sheikh, I., Dhiman, A., Yadav, N., Yadav, A.N., Rastegari, A.A., Singh, K. and Saxena, A.K., (2019). Endophytic fungi: biodiversity, ecological significance, and potential industrial applications. Recent advancement in white biotechnology through fungi (pp. 1-62). Springer, Cham. Rao, V.K., Girisham, S. and Reddy, S.M., (2014). Influence of different species of Penicillium and their culture filtrates on seed germination and seedling growth of sorghum. seed, 100, p.100x. 79 Rizwan, M., Ali, S., Qayyum, M.F., Ibrahim, M., Zia-ur-Rehman, M., Abbas, T. and Ok, Y.S., (2016). Mechanisms of biochar-mediated alleviation of toxicity of trace elements in plants: a critical review. Environmental Science and Pollution Research, 23(3), pp.2230-2248. Sanchis, V. and Magan, N., (2004). Environmental conditions affecting mycotoxins. Mycotoxins in food: Detection and control, pp.174-189. Sanders, I.R., (2011). Mycorrhizal symbioses: how to be seen as a good fungus. Current Biology, 21(14), pp.R550-R552. Savary, S., Willocquet, L., Pethybridge, S.J., Esker, P., McRoberts, N. and Nelson, A., (2019). The global burden of pathogens and pests on major food crops. Nature ecology & evolution, 3(3), pp.430-439. Sawant, A.M., Vankudoth, R., Navale, V., Kumavat, R., Kumari, P., Santhakumari, B. and Vamkudoth, K.R., (2019). Morphological and molecular characterization of Penicillium rubens sp. nov isolated from poultry feed. Indian Phytopathology, 72(3), pp.461-478. Schmidt, R., Cordovez, V., De Boer, W., Raaijmakers, J. and Garbeva, P., (2015). Volatile affairs in microbial interactions. The ISME journal, 9(11), pp.2329-2335. Shrestha, B., Lee, W.H., Han, S.K. and Sung, J.M., (2006). Observations on some of the mycelial growth and pigmentation characteristics of Cordyceps militaris isolates. Mycobiology, 34(2), pp.83-91. Shuping, D.S.S. and Eloff, J.N., (2017). The use of plants to protect plants and food against fungal pathogens: A review. African Journal of Traditional, Complementary and Alternative Medicines, 14(4), pp.120-127. Smith, L.L., DiTommaso, A., Lehmann, J. and Greipsson, S., (2008). Effects of arbuscular mycorrhizal fungi on the exotic invasive vine pale swallow-wort (Vincetoxicum rossicum). Invasive Plant Science and Management, 1(2), pp.142-152. Srinivas, C., Devi, D.N., Murthy, K.N., Mohan, C.D., Lakshmeesha, T.R., Singh, B., Kalagatur, N.K., Niranjana, S.R., Hashem, A., Alqarawi, A.A. and Tabassum, B., (2019). Fusarium oxysporum f. sp. lycopersici causal agent of vascular wilt disease of tomato: Biology to diversity–A review. Saudi journal of biological sciences, 26(7), pp.1315-1324. Sugiyama, A. and Yazaki, K., (2014). Flavonoids in plant rhizospheres: secretion, fate and their effects on biological communication. Plant Biotechnology, 31(5), pp.431-443. Suzuki, A., (2017). Various aspects of ammonia fungi. Developments in Fungal Biology and Applied Mycology (pp. 39-58). Springer, Singapore. Svahn, S., (2015). Analysis of secondary metabolites from Aspergillus fumigatus and Penicillium nalgiovense. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Pharmacy, p.195. Szczechura, W., Staniaszek, M. and Habdas, H., (2013). Fusarium oxysporum f. sp. radicis- lycopersici–the cause of Fusarium crown and root rot in tomato cultivation. Journal of plant protection research. Taylor, A.G., Goffinet, M.C., Pikuz, S.A., Shelkovenko, T.A., Mitchell, M.D., Chandler, K.M. and Hammer, D.A., (2003). Physico-chemical factors influence beet (Beta vulgaris L.) seed germination. The Biology of Seeds: Recent Research Advances. CABI, Wallingford, pp.433-440. Tiwari, K.L., Jadhav, S.K. and Kumar, A., (2011). Morphological and molecular study of different Penicillium species. Middle-East J Sci Res, 7(1), pp.203-10. Toghueo, R.M.K. and Boyom, F.F., (2020). Endophytic Penicillium species and their agricultural, biotechnological, and pharmaceutical applications. 3 Biotech, 10(3), p.107. 80 Tsang, C.C., Tang, J.Y., Lau, S.K. and Woo, P.C., (2018). Taxonomy and evolution of Aspergillus, Penicillium and Talaromyces in the omics era–past, present and future. Computational and structural biotechnology journal, 16, pp.197-210. Urooj, F.A.I.Z.A.H., Farhat, H.A.F.I.Z.A., Ali, S.A., Ahmed, M., Sultana, V., Shams, Z.I., Ara, J. and Ehteshamul-Haque, S., (2018). Role of endophytic Penicillium species in suppressing the root rotting fungi of sunflower. Pak. J. Bot, 50(4), pp.1621-1628. Validov, S.Z., Kamilova, F.D. and Lugtenberg, B.J., (2011). Monitoring of pathogenic and non‐pathogenic Fusarium oxysporum strains during tomato plant infection. Microbial biotechnology, 4(1), pp.82-88. Verma, C., Jandaik, S., Gupta, B.K., Kashyap, N., Suryaprakash, V.S., Kashyap, S. and Kerketta, A., (2020). Microbial metabolites in plant disease management: Review on biological approach. IJCS, 8(4), pp.2570-2581. Vierheilig, H., Schweiger, P. and Brundrett, M., (2005). An overview of methods for the detection and observation of arbuscular mycorrhizal fungi in roots. Physiologia Plantarum, 125(4), pp.393-404. Visagie, C.M., Hirooka, Y., Tanney, J.B., Whitfield, E., Mwange, K., Meijer, M., Amend, A.S., Seifert, K.A. and Samson, R.A., (2014). Aspergillus, Penicillium and Talaromyces isolated from house dust samples collected around the world. Studies in Mycology, 78, pp.63-139. Visagie, C.M., Houbraken, J., Frisvad, J.C., Hong, S.B., Klaassen, C.H.W., Perrone, G., Seifert, K.A., Varga, J., Yaguchi, T. and Samson, R.A., (2014). Identification and nomenclature of the genus Penicillium. Studies in mycology, 78, pp.343-371. Wang, G.L., Xiong, F., Que, F., Xu, Z.S., Wang, F. and Xiong, A.S., (2015). Morphological characteristics, anatomical structure, and gene expression: novel insights into gibberellin biosynthesis and perception during carrot growth and development. Horticulture research, 2(1), pp.1-10. Wang, L., Wang, Y., Ma, F., Tankpa, V., Bai, S., Guo, X. and Wang, X., (2019). Mechanisms and reutilization of modified biochar used for removal of heavy metals from wastewater: a review. Science of the total environment, 668, pp.1298-1309. Waqas, M., Khan, A.L., Hamayun, M., Shahzad, R., Kang, S.M., Kim, J.G. and Lee, I.J., (2015). Endophytic fungi promote plant growth and mitigate the adverse effects of stem rot: an example of Penicillium citrinum and Aspergillus terreus. Journal of plant interactions, 10(1), pp.280-287. Watts-Williams, S.J., Tyerman, S.D. and Cavagnaro, T.R., (2017). The dual benefit of arbuscular mycorrhizal fungi under soil zinc deficiency and toxicity: linking plant physiology and gene expression. Plant and Soil, 420(1-2), pp.375-388. Wehner, J., Antunes, P.M., Powell, J.R., Mazukatow, J. and Rillig, M.C., (2010). Plant pathogen protection by arbuscular mycorrhizas: a role for fungal diversity?. Pedobiologia, 53(3), pp.197-201. Weir, T.L., Perry, L.G., Gilroy, S. and Vivanco, J.M., (2010). The role of root exudates in rhizosphere interactions with plants and other organisms. Annual Review of Plant Biology, (errata). Whipps, J.M., (2001). Microbial interactions and biocontrol in the rhizosphere. Journal of experimental Botany, 52(suppl_1), pp.487-511. Wiednera, K. and Glaser, B., (2013). Biochar-fungi interactions in soils. Biochar and Soil Biota (eds Ladygina N, Rineau F), pp.69-99. Wightwick, A. and Allinson, G., (2007). Pesticide residues in Victorian waterways: a review. Australasian Journal of Ecotoxicology, 13(3), p.91. 81 Wightwick, A., Walters, R., Allinson, G., Reichman, S. and Menzies, N., (2010). Environmental risks of fungicides used in horticultural production systems. Fungicides, pp.273-304. Wightwick, A.M., Mollah, M.R., Partington, D.L. and Allinson, G., (2008). Copper fungicide residues in Australian vineyard soils. Journal of Agricultural and Food Chemistry, 56(7), pp.2457-2464. Wu, G., Jurick II, W.M., Lichtner, F.J., Peng, H., Yin, G., Gaskins, V.L., Yin, Y., Hua, S.S., Peter, K.A. and Bennett, J.W., (2019). Whole-genome comparisons of Penicillium spp. reveals secondary metabolic gene clusters and candidate genes associated with fungal aggressiveness during apple fruit decay. PeerJ, 7, p.e6170. Yao, Q., Liu, J., Yu, Z., Li, Y., Jin, J., Liu, X. and Wang, G., (2017). Three years of biochar amendment alters soil physiochemical properties and fungal community composition in a black soil of northeast China. Soil Biology and Biochemistry, 110, pp.56-67. Yoon, J.H., Hong, S.B., Ko, S.J. and Kim, S.H., (2007). Detection of extracellular enzyme activity in Penicillium using chromogenic media. Mycobiology, 35(3), pp.166-169. York, L.M., Carminati, A., Mooney, S.J., Ritz, K. and Bennett, M.J., (2016). The holistic rhizosphere: integrating zones, processes, and semantics in the soil influenced by roots. Journal of Experimental Botany, 67(12), pp.3629-3643. Yuce, E.K., Yigit, S. and Tosun, N., (2010). July. Efficacy of solarization combined with metam sodium and hydrogen peroxide in control of Fusarium oxysporum f. sp. radicis- lycopersici and Clavibacter michiganensis subsp. michiganensis in Tomato greenhouse. In III International Symposium on Tomato Diseases 914 (pp. 385-391). Zain, M.E., (2011). Impact of mycotoxins on humans and animals. Journal of Saudi chemical society, 15(2), pp.129-144. Zeilinger-Migsich, S. and Mukherjee, P.K., (2014). Fungus-Fungus Interactions. Open Mycology Journal, 8(1), p.27. Zhang, Q., Wang, Y., Wu, Y., Wang, X., Du, Z., Liu, X. and Song, J., (2013). Effects of biochar amendment on soil thermal conductivity, reflectance, and temperature. Soil Science Society of America Journal, 77(5), pp.1478-1487. Zhao, J., Mei, Z., Zhang, X., Xue, C., Zhang, C., Ma, T. and Zhang, S., (2017). Suppression of Fusarium wilt of cucumber by ammonia gas fumigation via reduction of Fusarium population in the field. Scientific reports, 7(1), pp.1-8. Zheng, W., Sharma, B.K. and Rajagopalan, N., (2010). Using biochar as a soil amendment for sustainable agriculture. Resource Recovery. Zhou, D., Liu, D., Gao, F., Li, M. and Luo, X., (2017). Effects of biochar-derived sewage sludge on heavy metal adsorption and immobilization in soils. International journal of environmental research and public health, 14(7), p.681. 82 APPENDICES APPENDIX A: BLAST CONSENSUS RESULTS FOR ALL ISOLATED SPECIES (CHAPTER TWO) BLAST consensus for Penicillium spp1 results showed that the following species produces alignments that are significant to the species. RID: STGXS6RS015 Database: nt_v5 Query= Penicillium spp1 Consensus Score E Sequences producing significant alignments: (Bits) Value gi|1595603195|gb|MK660351.1| Penicillium commune strain QLM2 ... 1026 0E00 gi|1595603185|gb|MK660341.1| Penicillium commune strain P6 sm... 1026 0E00 gi|1595603179|gb|MK660335.1| Penicillium commune strain M170 ... 1026 0E00 gi|1595603178|gb|MK660334.1| Penicillium commune strain M145 ... 1026 0E00 gi|1678639092|ref|NR_163685.1| Penicillium caseifulvum CBS 10... 1024 0E00 gi|1678639076|ref|NR_163669.1| Penicillium fuscoglaucum CBS 2... 1024 0E00 gi|1531397796|gb|MK268135.1| Penicillium commune isolate R972... 1024 0E00 gi|1531397779|gb|MK268118.1| Penicillium commune isolate R971... 1024 0E00 gi|1531397170|gb|MK267509.1| Penicillium commune isolate E204... 1024 0E00 gi|1531397169|gb|MK267508.1| Penicillium commune isolate E204... 1024 0E00 gi|1531397121|gb|MK267460.1| Penicillium commune isolate E204... 1024 0E00 gi|1531397089|gb|MK267428.1| Penicillium commune isolate E203... 1024 0E00 gi|1531397088|gb|MK267427.1| Penicillium commune isolate E203... 1024 0E00 gi|1531397087|gb|MK267426.1| Penicillium commune isolate E203... 1024 0E00 gi|1531397086|gb|MK267425.1| Penicillium commune isolate E203... 1024 0E00 gi|1531397083|gb|MK267422.1| Penicillium commune isolate E203... 1024 0E00 gi|1523715712|gb|MK226538.1| Penicillium palitans isolate CBS... 1024 0E00 gi|1473249778|gb|MH862722.1| Penicillium caseifulvum strain C... 1024 0E00 gi|1473245902|gb|MH858846.1| Penicillium verrucosum strain CB... 1024 0E00 gi|1473243408|gb|MH856352.1| Penicillium commune strain CBS 2... 1024 0E00 gi|1473242118|gb|MH855062.1| Penicillium fuscoglaucum strain ... 1024 0E00 gi|1465463445|gb|MG733678.1| Penicillium oxalicum strain APBS... 1024 0E00 gi|1450319269|gb|MF803944.1| Penicillium palitans isolate DTO... 1024 0E00 gi|1149033129|gb|KY643771.1| Penicillium commune strain LCZ5 ... 1024 0E00 gi|1040718938|dbj|LC145288.1| Penicillium sp. T7508-1-2 genes... 1024 0E00 gi|996130059|gb|KR233455.1| Penicillium oxalicum strain PO15 ... 1024 0E00 gi|731445980|gb|KP132490.1| Penicillium commune strain IHEM 1... 1024 0E00 gi|443429719|gb|KC009817.1| Penicillium commune strain H09-10... 1024 0E00 gi|443429716|gb|KC009814.1| Penicillium commune strain H09-09... 1024 0E00 gi|443429704|gb|KC009802.1| Penicillium commune strain H09-08... 1024 0E00 gi|401878799|gb|JX171184.1| Penicillium commune isolate LKF10... 1024 0E00 gi|259018338|gb|GQ458026.1| Penicillium commune strain MA09-A... 1024 0E00 gi|187884378|gb|EU664481.1| Penicillium camemberti strain 095... 1024 0E00 gi|187884358|gb|EU664463.1| Penicillium camemberti strain 082... 1024 0E00 gi|187884357|gb|EU664462.1| Penicillium camemberti strain 095... 1024 0E00 gi|3925707|emb|AJ004813.1| Penicillium commune DNA for 5.8S r... 1024 0E00 gi|1584734763|gb|MK580820.1| Penicillium commune isolate gel ... 1022 0E00 gi|1561008385|gb|MK424124.1| Penicillium sp. isolate Cr_FuPnl... 1022 0E00 gi|1046760650|gb|KU561925.1| Penicillium commune strain aT3 1... 1022 0E00 gi|34809385|gb|AY373905.1| Penicillium commune strain ATCC 10... 1022 0E00 gi|597900478|ref|NR_111143.1| Penicillium commune CBS 311.48 ... 1022 0E00 gi|1735093903|gb|MN413150.1| Penicillium cavernicola strain C... 1019 0E00 gi|1678639091|ref|NR_163684.1| Penicillium cavernicola CBS 10... 1019 0E00 gi|1473249765|gb|MH862709.1| Penicillium cavernicola strain C... 1019 0E00 83 gi|1473245998|gb|MH858942.1| Penicillium camemberti strain CB... 1019 0E00 gi|1473243411|gb|MH856355.1| Penicillium camemberti strain CB... 1019 0E00 gi|1473242121|gb|MH855065.1| Penicillium commune strain CBS 2... 1019 0E00 gi|1473241639|gb|MH854583.1| Penicillium camemberti strain CB... 1019 0E00 gi|1450319270|gb|MF803945.1| Penicillium palitans isolate DTO... 1019 0E00 gi|1386784040|gb|MG490880.1| Penicillium cf. discolor strain ... 1019 0E00 ALIGNMENTS >gb|MK660351.1| Penicillium commune strain QLM2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Length=589 Score = 1025.6 bits (1136), Expect = 0E00 Identities = 568/568 (100%), Gaps = 0/568 (0%) Strand = Plus/Minus Query 1 TTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGATAAAAATTTGGGTTGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 568 TTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGATAAAAATTTGGGTTGA 509 Query 61 TCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 508 TCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCG 449 Query 121 GACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGAGATCGGAGGACGGGGCCCAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 448 GACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGAGATCGGAGGACGGGGCCCAA 389 Query 181 CACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 388 CACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACC 329 Query 241 AGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTTGCAATTCACATTACG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 328 AGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTTGCAATTCACATTACG 269 Query 301 TATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 268 TATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTT 209 Query 361 TTAAATAATTTATATTTTCACTCAGACTTCAATCTTCAGACAGAGTTCGAGGGTGTCTTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 208 TTAAATAATTTATATTTTCACTCAGACTTCAATCTTCAGACAGAGTTCGAGGGTGTCTTC 149 Query 421 GGCGGGCGCGGGCCCGGGGGCGTGAGCCCCCCGGCGGCCAGTTAAGGCGGGCCCGCCGAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 148 GGCGGGCGCGGGCCCGGGGGCGTGAGCCCCCCGGCGGCCAGTTAAGGCGGGCCCGCCGAA 89 Query 481 GCAACAAGGTAAAATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 88 GCAACAAGGTAAAATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAAT 29 Query 541 GATCCTTCCGCAGGTTCACCTACGGAAG 568 |||||||||||||||||||||||||||| Sbjct 28 GATCCTTCCGCAGGTTCACCTACGGAAG 1 84 BLAST consensus for Penicillium spp2 results showed that the following species produces alignments that are significant to the species. RID: STGZW2FT015 Database: nt_v5 Query= Penicillium spp2 Consensus Score E Sequences producing significant alignments: (Bits) Value gi|1595603179|gb|MK660335.1| Penicillium commune strain M170 ... 1059 0E00 gi|1595603185|gb|MK660341.1| Penicillium commune strain P6 sm... 1054 0E00 gi|1595603178|gb|MK660334.1| Penicillium commune strain M145 ... 1054 0E00 gi|1678639076|ref|NR_163669.1| Penicillium fuscoglaucum CBS 2... 1054 0E00 gi|1531397796|gb|MK268135.1| Penicillium commune isolate R972... 1054 0E00 gi|1531397779|gb|MK268118.1| Penicillium commune isolate R971... 1054 0E00 gi|1531397170|gb|MK267509.1| Penicillium commune isolate E204... 1054 0E00 gi|1531397169|gb|MK267508.1| Penicillium commune isolate E204... 1054 0E00 gi|1531397121|gb|MK267460.1| Penicillium commune isolate E204... 1054 0E00 gi|1531397089|gb|MK267428.1| Penicillium commune isolate E203... 1054 0E00 gi|1531397088|gb|MK267427.1| Penicillium commune isolate E203... 1054 0E00 gi|1531397087|gb|MK267426.1| Penicillium commune isolate E203... 1054 0E00 gi|1531397086|gb|MK267425.1| Penicillium commune isolate E203... 1054 0E00 gi|1531397083|gb|MK267422.1| Penicillium commune isolate E203... 1054 0E00 gi|1523715712|gb|MK226538.1| Penicillium palitans isolate CBS... 1054 0E00 gi|1473242118|gb|MH855062.1| Penicillium fuscoglaucum strain ... 1054 0E00 gi|1465463445|gb|MG733678.1| Penicillium oxalicum strain APBS... 1054 0E00 gi|1450319269|gb|MF803944.1| Penicillium palitans isolate DTO... 1054 0E00 gi|996130059|gb|KR233455.1| Penicillium oxalicum strain PO15 ... 1054 0E00 gi|443429719|gb|KC009817.1| Penicillium commune strain H09-10... 1054 0E00 gi|443429716|gb|KC009814.1| Penicillium commune strain H09-09... 1054 0E00 gi|259018338|gb|GQ458026.1| Penicillium commune strain MA09-A... 1054 0E00 gi|187884378|gb|EU664481.1| Penicillium camemberti strain 095... 1054 0E00 gi|3925707|emb|AJ004813.1| Penicillium commune DNA for 5.8S r... 1054 0E00 gi|1584734763|gb|MK580820.1| Penicillium commune isolate gel ... 1052 0E00 gi|1561008385|gb|MK424124.1| Penicillium sp. isolate Cr_FuPnl... 1052 0E00 gi|34809385|gb|AY373905.1| Penicillium commune strain ATCC 10... 1052 0E00 gi|597900478|ref|NR_111143.1| Penicillium commune CBS 311.48 ... 1052 0E00 gi|1735093903|gb|MN413150.1| Penicillium cavernicola strain C... 1049 0E00 gi|1450319270|gb|MF803945.1| Penicillium palitans isolate DTO... 1049 0E00 gi|1386784040|gb|MG490880.1| Penicillium cf. discolor strain ... 1049 0E00 gi|1386784037|gb|MG490877.1| Penicillium cf. discolor strain ... 1049 0E00 gi|1386784029|gb|MG490869.1| Penicillium cf. discolor strain ... 1049 0E00 gi|1386784028|gb|MG490868.1| Penicillium cf. discolor strain ... 1049 0E00 gi|1386784027|gb|MG490867.1| Penicillium cf. discolor strain ... 1049 0E00 gi|1386784026|gb|MG490866.1| Penicillium cf. discolor strain ... 1049 0E00 gi|1334684241|gb|KY469068.1| Penicillium camemberti strain KA... 1049 0E00 gi|1334684240|gb|KY469067.1| Penicillium camemberti strain KA... 1049 0E00 gi|1334684239|gb|KY469066.1| Penicillium camemberti strain KA... 1049 0E00 gi|1334684238|gb|KY469065.1| Penicillium camemberti strain KA... 1049 0E00 gi|1334684237|gb|KY469064.1| Penicillium camemberti strain KA... 1049 0E00 gi|1334684236|gb|KY469063.1| Penicillium camemberti strain KA... 1049 0E00 gi|1334684235|gb|KY469062.1| Penicillium camemberti strain KA... 1049 0E00 gi|699340823|gb|KM232463.1| Penicillium sp. 5H1-P0-P5-3 strai... 1049 0E00 gi|530692585|gb|KF212277.1| Fungal sp. APA-2013 clone LJ133Ms... 1049 0E00 gi|443429721|gb|KC009819.1| Penicillium commune strain H09-10... 1049 0E00 gi|373938716|gb|JN642222.1| Penicillium solitum strain 20-01 ... 1049 0E00 gi|262118032|dbj|AB479314.1| Penicillium camemberti genes for... 1049 0E00 gi|259018351|gb|GQ458039.1| Penicillium camemberti strain ATC... 1049 0E00 gi|259018332|gb|GQ458020.1| Penicillium camemberti strain MA0... 1049 0E00 85 ALIGNMENTS >gb|MK660335.1| Penicillium commune strain M170 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Length=589 Score = 1059.0 bits (1173), Expect = 0E00 Identities = 588/589 (99%), Gaps = 0/589 (0%) Strand = Plus/Minus Query 1 TCCTCCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAC 60 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 589 TCCTTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAC 530 Query 61 CTGGATAAAAATTTGGGTTGATCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 529 CTGGATAAAAATTTGGGTTGATCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAA 470 Query 121 GCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 469 GCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGG 410 Query 181 AGATCGGAGGACGGGGCCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 409 AGATCGGAGGACGGGGCCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGAC 350 Query 241 AGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 349 AGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACT 290 Query 301 GAATTTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 289 GAATTTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCA 230 Query 361 AGAGATCCGTTGTTGAAAGTTTTAAATAATTTATATTTTCACTCAGACTTCAATCTTCAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 229 AGAGATCCGTTGTTGAAAGTTTTAAATAATTTATATTTTCACTCAGACTTCAATCTTCAG 170 Query 421 ACAGAGTTCGAGGGTGTCTTCGGCGGGCGCGGGCCCGGGGGCGTGAGCCCCCCGGCGGCC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 169 ACAGAGTTCGAGGGTGTCTTCGGCGGGCGCGGGCCCGGGGGCGTGAGCCCCCCGGCGGCC 110 Query 481 AGTTAAGGCGGGCCCGCCGAAGCAACAAGGTAAAATAAACACGGGTGGGAGGTTGGACCC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 109 AGTTAAGGCGGGCCCGCCGAAGCAACAAGGTAAAATAAACACGGGTGGGAGGTTGGACCC 50 Query 541 AGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAG 589 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 49 AGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAG 1 86 BLAST consensus for Penicillium spp3 results showed that the following species produces alignments that are significant to the species. RID: SW337SHV014 Database: nt_v5 Query= Penicillium spp3 Consensus Score E Sequences producing significant alignments: (Bits) Value gi|1704721198|gb|MN178806.1| Aspergillus fumigatus isolate TB... 807 0E00 gi|1704721198|gb|MN178806.1| Aspergillus fumigatus isolate TB... 64 6E-06 gi|1677556527|gb|MN006422.1| Aspergillus fumigatus isolate AB... 807 0E00 gi|1677556527|gb|MN006422.1| Aspergillus fumigatus isolate AB... 139 3E-28 gi|1655483383|gb|MK952424.1| Aspergillus fumigatus strain AfB... 807 0E00 gi|1655483383|gb|MK952424.1| Aspergillus fumigatus strain AfB... 84 6E-12 gi|1653966441|gb|MK054270.1| Aspergillus sp. isolate Z2 inter... 807 0E00 gi|1653966441|gb|MK054270.1| Aspergillus sp. isolate Z2 inter... 85 6E-12 gi|1624800035|gb|MK841450.1| Aspergillus fumigatus voucher NW... 807 0E00 gi|1624800035|gb|MK841450.1| Aspergillus fumigatus voucher NW... 75 3E-09 gi|1624800021|gb|MK841436.1| Aspergillus fumigatus voucher NW... 807 0E00 gi|1624800021|gb|MK841436.1| Aspergillus fumigatus voucher NW... 71 1E-07 gi|1624800018|gb|MK841433.1| Aspergillus fumigatus voucher NW... 807 0E00 gi|1624800018|gb|MK841433.1| Aspergillus fumigatus voucher NW... 66 2E-06 gi|1624800016|gb|MK841431.1| Aspergillus fumigatus voucher NW... 807 0E00 gi|1624800016|gb|MK841431.1| Aspergillus fumigatus voucher NW... 75 3E-09 gi|1622715532|gb|MK817529.1| Aspergillus fumigatus strain 355... 807 0E00 gi|1622715532|gb|MK817529.1| Aspergillus fumigatus strain 355... 77 9E-10 gi|1607212468|gb|MK751709.1| Aspergillus fumigatus strain M4 ... 807 0E00 gi|1605372086|gb|MH892837.1| Aspergillus fumigatus isolate S1... 807 0E00 gi|1605372086|gb|MH892837.1| Aspergillus fumigatus isolate S1... 164 8E-36 gi|1591436826|gb|MK630344.1| Aspergillus fumigatus strain ZC-... 807 0E00 gi|1591436826|gb|MK630344.1| Aspergillus fumigatus strain ZC-... 84 6E-12 gi|1590834702|gb|MK623263.1| Aspergillus fumigatus isolate C1... 807 0E00 gi|1590834702|gb|MK623263.1| Aspergillus fumigatus isolate C1... 157 1E-33 gi|1531381882|gb|MK267099.1| Aspergillus fumigatus isolate RS... 807 0E00 gi|1531381882|gb|MK267099.1| Aspergillus fumigatus isolate RS... 162 3E-35 gi|1524758986|gb|MK243451.1| Aspergillus fumigatus isolate GL... 807 0E00 gi|1524758986|gb|MK243451.1| Aspergillus fumigatus isolate GL... 71 1E-07 gi|1524758966|gb|MK243397.1| Aspergillus fumigatus isolate GL... 807 0E00 gi|1524758966|gb|MK243397.1| Aspergillus fumigatus isolate GL... 81 7E-11 gi|1476494148|gb|MH911420.1| Aspergillus fumigatus strain MF2... 807 0E00 gi|1476494148|gb|MH911420.1| Aspergillus fumigatus strain MF2... 158 3E-34 gi|1476494144|gb|MH911416.1| Aspergillus fumigatus strain MF2... 807 0E00 gi|1476494144|gb|MH911416.1| Aspergillus fumigatus strain MF2... 162 3E-35 gi|1476494125|gb|MH911397.1| Aspergillus fumigatus strain MF2... 807 0E00 gi|1476494125|gb|MH911397.1| Aspergillus fumigatus strain MF2... 164 8E-36 gi|1476494112|gb|MH911384.1| Aspergillus fumigatus strain MF2... 807 0E00 gi|1476494112|gb|MH911384.1| Aspergillus fumigatus strain MF2... 146 2E-30 gi|1573068568|gb|MH484011.1| Aspergillus fumigatus isolate BN... 807 0E00 gi|1573068568|gb|MH484011.1| Aspergillus fumigatus isolate BN... 69 5E-07 gi|1564308349|gb|MK461083.1| Aspergillus fumigatus strain IR3... 807 0E00 gi|1564308349|gb|MK461083.1| Aspergillus fumigatus strain IR3... 124 7E-24 gi|1564307561|gb|MK460927.1| Aspergillus fumigatus strain CR3... 807 0E00 gi|1564307528|gb|MK460917.1| Aspergillus fumigatus strain CR2... 807 0E00 gi|1564307528|gb|MK460917.1| Aspergillus fumigatus strain CR2... 132 5E-26 gi|1562063245|gb|MK439477.1| Aspergillus sp. isolate CK392 sm... 807 0E00 gi|1562063245|gb|MK439477.1| Aspergillus sp. isolate CK392 sm... 162 3E-35 gi|1546451089|gb|MK351862.1| Aspergillus fumigatus small subu... 807 0E00 gi|1546451089|gb|MK351862.1| Aspergillus fumigatus small subu... 156 1E-33 gi|1444363069|gb|MH725579.1| Aspergillus fumigatus isolate HN... 807 0E00 gi|1444363069|gb|MH725579.1| Aspergillus fumigatus isolate HN... 82 2E-11 87 gi|1444356936|gb|MH725577.1| Aspergillus fumigatus isolate HN... 807 0E00 gi|1444356936|gb|MH725577.1| Aspergillus fumigatus isolate HN... 79 3E-10 gi|1444345339|gb|MH725575.1| Aspergillus fumigatus isolate HN... 807 0E00 gi|1444345339|gb|MH725575.1| Aspergillus fumigatus isolate HN... 82 7E-11 gi|1442330471|gb|MG462851.1| Uncultured Aspergillus clone GM5... 807 0E00 gi|1442330471|gb|MG462851.1| Uncultured Aspergillus clone GM5... 84 6E-12 gi|1406194617|gb|MH497165.1| Fungal sp. isolate 14A2 internal... 807 0E00 gi|1406194617|gb|MH497165.1| Fungal sp. isolate 14A2 internal... 69 5E-07 gi|1389448002|gb|MH345956.1| Aspergillus fumigatus isolate 11... 807 0E00 gi|1389448002|gb|MH345956.1| Aspergillus fumigatus isolate 11... 72 4E-08 gi|1389447917|gb|MH345871.1| Aspergillus fumigatus isolate 31... 807 0E00 gi|1389447917|gb|MH345871.1| Aspergillus fumigatus isolate 31... 67 2E-06 gi|1389447910|gb|MH345864.1| Aspergillus fumigatus isolate 24... 807 0E00 gi|1389447910|gb|MH345864.1| Aspergillus fumigatus isolate 24... 71 1E-07 gi|1389447906|gb|MH345860.1| Aspergillus fumigatus isolate 20... 807 0E00 gi|1389447906|gb|MH345860.1| Aspergillus fumigatus isolate 20... 66 2E-06 gi|1389447903|gb|MH345857.1| Aspergillus fumigatus isolate 17... 807 0E00 gi|1389447903|gb|MH345857.1| Aspergillus fumigatus isolate 17... 79 3E-10 gi|1389447902|gb|MH345856.1| Aspergillus fumigatus isolate 16... 807 0E00 gi|1389447902|gb|MH345856.1| Aspergillus fumigatus isolate 16... 71 1E-07 gi|1389447901|gb|MH345855.1| Aspergillus fumigatus isolate 15... 807 0E00 gi|1389447901|gb|MH345855.1| Aspergillus fumigatus isolate 15... 77 9E-10 gi|1389447896|gb|MH345850.1| Aspergillus fumigatus isolate 10... 807 0E00 gi|1389447896|gb|MH345850.1| Aspergillus fumigatus isolate 10... 75 3E-09 gi|1389447894|gb|MH345848.1| Aspergillus fumigatus isolate 8 ... 807 0E00 gi|1389447894|gb|MH345848.1| Aspergillus fumigatus isolate 8 ... 71 1E-07 gi|1389387579|gb|MF374838.1| Aspergillus fumigatus isolate AS... 807 0E00 gi|1384787902|gb|MH270614.1| Aspergillus fumigatus strain ND1... 807 0E00 gi|1384787902|gb|MH270614.1| Aspergillus fumigatus strain ND1... 79 3E-10 gi|1384787896|gb|MH270608.1| Aspergillus fumigatus strain ND1... 807 0E00 gi|1384787896|gb|MH270608.1| Aspergillus fumigatus strain ND1... 77 9E-10 gi|1384787890|gb|MH270602.1| Aspergillus fumigatus strain NR7... 807 0E00 gi|1384787890|gb|MH270602.1| Aspergillus fumigatus strain NR7... 67 2E-06 gi|1384787878|gb|MH270590.1| Aspergillus fumigatus strain NR6... 807 0E00 gi|1384787878|gb|MH270590.1| Aspergillus fumigatus strain NR6... 85 6E-12 gi|1384787860|gb|MH270572.1| Aspergillus fumigatus strain NR4... 807 0E00 gi|1384787857|gb|MH270569.1| Aspergillus fumigatus strain NR4... 807 0E00 gi|1384787857|gb|MH270569.1| Aspergillus fumigatus strain NR4... 78 9E-10 gi|1384787843|gb|MH270555.1| Aspergillus fumigatus strain NR2... 807 0E00 gi|1384787843|gb|MH270555.1| Aspergillus fumigatus strain NR2... 60 2E-04 gi|1354562356|gb|KY827337.1| Aspergillus fumigatus strain SCA... 807 0E00 gi|1354562356|gb|KY827337.1| Aspergillus fumigatus strain SCA... 77 9E-10 gi|1349758592|gb|MG991675.1| Aspergillus fumigatus strain CMX... 807 0E00 gi|1349758592|gb|MG991675.1| Aspergillus fumigatus strain CMX... 164 8E-36 ALIGNMENTS >gb|MN178806.1| Aspergillus fumigatus isolate TB1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Length=568 Score = 807.4 bits (894), Expect = 0E00 Identities = 447/447 (100%), Gaps = 0/447 (0%) Strand = Plus/Minus Query 1 TTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 567 TTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAC 508 88 Query 61 CTTAGAAAAATAAAGTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 507 CTTAGAAAAATAAAGTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAA 448 Query 121 AGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 447 AGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCG 388 Query 181 GGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 387 GGAGAGGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGA 328 Query 241 CAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCAC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 327 CAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCAC 268 Query 301 TGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAAC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 267 TGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAAC 208 Query 361 CAAGAGATCCGTTGTTGAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 207 CAAGAGATCCGTTGTTGAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTT 148 Query 421 TCAGAACAGCGTTCATGTTGGGGTCTT 447 ||||||||||||||||||||||||||| Sbjct 147 TCAGAACAGCGTTCATGTTGGGGTCTT 121 BLAST consensus for Penicillium spp4 results showed that the following species produces alignments that are significant to the species. RID: T38PRS74015 Database: nt_v5 Query= Penicillium spp4 Consensus Score E Sequences producing significant alignments: (Bits) Value gi|1624800039|gb|MK841454.1| Penicillium concavorugulosum vou... 992 0E00 gi|1547055358|gb|MK359013.1| Talaromyces sp. isolate OUCMDZ-5... 992 0E00 gi|1547054995|gb|MK358958.1| Fungal sp. isolate OUCMDZ-5185 s... 992 0E00 gi|1042744258|gb|KU839281.1| Fungal sp. strain S212T internal... 992 0E00 gi|1042744257|gb|KU839280.1| Fungal sp. strain S212S internal... 992 0E00 gi|1042744256|gb|KU839279.1| Fungal sp. strain S212R internal... 992 0E00 gi|1042742701|gb|KU837725.1| Fungal sp. strain P279A internal... 992 0E00 gi|1004525520|gb|KU216713.1| Talaromyces variabilis strain XQ... 992 0E00 gi|725095821|gb|KF984800.1| Talaromyces sublevisporus strain ... 992 0E00 gi|299767731|gb|GQ999323.1| Uncultured fungus clone LX042768-... 992 0E00 gi|673921011|emb|LN482471.1| Talaromyces radicus genomic DNA ... 992 0E00 gi|326579935|gb|HM469413.1| Talaromyces radicus strain KUC167... 992 0E00 gi|171464364|gb|EU262660.1| Talaromyces radicus strain MET090... 992 0E00 gi|725095818|gb|KF984797.1| Talaromyces variabilis strain NRR... 988 0E00 gi|725095816|gb|KF984795.1| Talaromyces variabilis strain DTO... 988 0E00 gi|299767729|gb|GQ999321.1| Uncultured fungus clone LX042768-... 988 0E00 gi|299767727|gb|GQ999319.1| Uncultured fungus clone LX042768-... 988 0E00 gi|511783057|gb|KC466524.1| Talaromyces variabilis 18S riboso... 988 0E00 gi|311235642|gb|HQ288049.1| Penicillium variabile strain NRRL... 986 0E00 gi|299767730|gb|GQ999322.1| Uncultured fungus clone LX042768-... 983 0E00 gi|1594472747|gb|MK646059.1| Talaromyces radicus isolate JJGG... 981 0E00 gi|321172822|gb|HQ698594.1| Penicillium variabile strain NRRL... 980 0E00 gi|361052000|gb|JN851019.1| Talaromyces radicus strain SCSGAF... 979 0E00 gi|1584169938|gb|MK577438.1| Penicillium sp. isolate QM-M sma... 978 0E00 89 gi|1628757350|gb|MH935987.1| Talaromyces sp. strain 6HVCE1 sm... 972 0E00 gi|1511001243|gb|MG957181.1| Talaromyces variabilis isolate 4... 971 0E00 gi|1005417929|gb|KT958549.1| Talaromyces radicus strain DsppF... 971 0E00 gi|961554357|gb|KT264430.1| Talaromyces sp. isolate AM081-P10... 971 0E00 gi|498922946|gb|KC920846.1| Talaromyces radicus isolate CrP20... 971 0E00 gi|1526299447|gb|MH006605.1| Talaromyces variabilis isolate 2... 967 0E00 gi|1347308147|gb|MG976292.1| Talaromyces wortmannii isolate 4... 965 0E00 gi|1473252768|gb|MH865712.1| Talaromyces wortmannii strain CB... 965 0E00 gi|1473245354|gb|MH858298.1| Talaromyces wortmannii strain CB... 965 0E00 gi|1473243468|gb|MH856412.1| Talaromyces wortmannii strain CB... 965 0E00 gi|1042744486|gb|KU839509.1| Fungal sp. strain S252D internal... 965 0E00 gi|1042744460|gb|KU839483.1| Fungal sp. strain S248J internal... 965 0E00 gi|1042744442|gb|KU839465.1| Fungal sp. strain S246M internal... 965 0E00 gi|1042744441|gb|KU839464.1| Fungal sp. strain S246I internal... 965 0E00 gi|1042744440|gb|KU839463.1| Fungal sp. strain S246H internal... 965 0E00 gi|1042744439|gb|KU839462.1| Fungal sp. strain S246G internal... 965 0E00 gi|1042744250|gb|KU839273.1| Fungal sp. strain S212K internal... 965 0E00 gi|1042744118|gb|KU839141.1| Fungal sp. strain S195T internal... 965 0E00 gi|1042744112|gb|KU839135.1| Fungal sp. strain S194T internal... 965 0E00 gi|1042744111|gb|KU839134.1| Fungal sp. strain S194S internal... 965 0E00 gi|1042744109|gb|KU839132.1| Fungal sp. strain S194N internal... 965 0E00 gi|1042744104|gb|KU839127.1| Fungal sp. strain S194C internal... 965 0E00 gi|1042744103|gb|KU839126.1| Fungal sp. strain S194B internal... 965 0E00 gi|1042744102|gb|KU839125.1| Fungal sp. strain S194A internal... 965 0E00 gi|1042744052|gb|KU839075.1| Fungal sp. strain S179B internal... 965 0E00 gi|1127908509|gb|KY425712.1| Talaromyces variabilis strain E1... 965 0E00 ALIGNMENTS >gb|MK841454.1| Penicillium concavorugulosum voucher NWUSeq42 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Length=570 Score = 992.2 bits (1099), Expect = 0E00 Identities = 550/551 (99%), Gaps = 0/551 (0%) Strand = Plus/Minus Query 1 TCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGCCCTACCTGATCCGAGGTCAACC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 569 TCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGCCCTACCTGATCCGAGGTCAACC 510 Query 61 GGAAGAGGCGCACCCCGAAGGGCGGCCTAAAGGGAAGACCAGCGCCGACCGAGTCCCTCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 509 GGAAGAGGCGCACCCCGAAGGGCGGCCTAAAGGGAAGACCAGCGCCGACCGAGTCCCTCC 450 Query 121 CGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCCGACGCGGCGCCGCCACTGCTTTTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 449 CGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCCGACGCGGCGCCGCCACTGCTTTTG 390 Query 181 GGGCGTGTCCCCGGGGGGACAGCGCCCAACACCCAGCCGTGCTGGAGGGCAGAAATGACG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 389 GGGCGTGTCCCCGGGGGGACAGCGCCCAACACCCAGCCGTGCTGGAGGGCAGAAATGACG 330 Query 241 CTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 329 CTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATG 270 90 Query 301 ATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 269 ATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGC 210 Query 361 CGGAACCAAGAGATCCGTTGTTGAAAGTTTTAATGATTTCAAATCTCACTCAGACTCACT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 209 CGGAACCAAGAGATCCGTTGTTGAAAGTTTTAATGATTTCAAATCTCACTCAGACTCACT 150 Query 421 ATTCAGGCAGGGTTCTAGGGTGCGTCGGCGGGCGCGGGCCCGGGGGCAGAAGCCCCCCGG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 149 ATTCAGGCAGGGTTCTAGGGTGCGTCGGCGGGCGCGGGCCCGGGGGCAGAAGCCCCCCGG 90 Query 481 CGACCGGGGCCAGGCSCCAGTGGGCCCGCCGAGGCAACGCGGTAACGGTAAACACGGGTG 540 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct 89 CGACCGGGGCCAGGCCCCAGTGGGCCCGCCGAGGCAACGCGGTAACGGTAAACACGGGTG 30 Query 541 GGAGGTTGGGC 551 ||||||||||| Sbjct 29 GGAGGTTGGGC 19 BLAST consensus for Penicillium spp5 results showed that the following species produces alignments that are significant to the species. RID: T38R4RF8015 Database: nt_v5 Query= Penicillium spp5 Consensus Score E Sequences producing significant alignments: (Bits) Value gi|1624800039|gb|MK841454.1| Penicillium concavorugulosum vou... 797 0E00 gi|1624800039|gb|MK841454.1| Penicillium concavorugulosum vou... 91 1E-13 gi|1547055358|gb|MK359013.1| Talaromyces sp. isolate OUCMDZ-5... 797 0E00 gi|1547055358|gb|MK359013.1| Talaromyces sp. isolate OUCMDZ-5... 159 3E-34 gi|1547055358|gb|MK359013.1| Talaromyces sp. isolate OUCMDZ-5... 797 0E00 gi|1547055358|gb|MK359013.1| Talaromyces sp. isolate OUCMDZ-5... 159 3E-34 gi|1547054995|gb|MK358958.1| Fungal sp. isolate OUCMDZ-5185 s... 797 0E00 gi|1547054995|gb|MK358958.1| Fungal sp. isolate OUCMDZ-5185 s... 149 2E-31 gi|1547054995|gb|MK358958.1| Fungal sp. isolate OUCMDZ-5185 s... 797 0E00 gi|1547054995|gb|MK358958.1| Fungal sp. isolate OUCMDZ-5185 s... 149 2E-31 gi|1042744258|gb|KU839281.1| Fungal sp. strain S212T internal... 797 0E00 gi|1042744258|gb|KU839281.1| Fungal sp. strain S212T internal... 115 4E-21 gi|1042744257|gb|KU839280.1| Fungal sp. strain S212S internal... 797 0E00 gi|1042744257|gb|KU839280.1| Fungal sp. strain S212S internal... 144 7E-30 gi|1042744256|gb|KU839279.1| Fungal sp. strain S212R internal... 797 0E00 gi|1042744256|gb|KU839279.1| Fungal sp. strain S212R internal... 119 3E-22 gi|1042742701|gb|KU837725.1| Fungal sp. strain P279A internal... 797 0E00 gi|1042742701|gb|KU837725.1| Fungal sp. strain P279A internal... 115 4E-21 gi|1004525520|gb|KU216713.1| Talaromyces variabilis strain XQ... 797 0E00 gi|1004525520|gb|KU216713.1| Talaromyces variabilis strain XQ... 159 3E-34 gi|1004525520|gb|KU216713.1| Talaromyces variabilis strain XQ... 77 9E-10 gi|725095821|gb|KF984800.1| Talaromyces sublevisporus strain ... 797 0E00 gi|725095821|gb|KF984800.1| Talaromyces sublevisporus strain ... 129 2E-25 gi|725095818|gb|KF984797.1| Talaromyces variabilis strain NRR... 797 0E00 gi|725095818|gb|KF984797.1| Talaromyces variabilis strain NRR... 129 2E-25 gi|299767731|gb|GQ999323.1| Uncultured fungus clone LX042768-... 797 0E00 gi|299767731|gb|GQ999323.1| Uncultured fungus clone LX042768-... 159 3E-34 gi|299767729|gb|GQ999321.1| Uncultured fungus clone LX042768-... 797 0E00 gi|299767729|gb|GQ999321.1| Uncultured fungus clone LX042768-... 155 4E-33 gi|673921011|emb|LN482471.1| Talaromyces radicus genomic DNA ... 797 0E00 gi|673921011|emb|LN482471.1| Talaromyces radicus genomic DNA ... 157 1E-33 gi|361052000|gb|JN851019.1| Talaromyces radicus strain SCSGAF... 797 0E00 91 gi|361052000|gb|JN851019.1| Talaromyces radicus strain SCSGAF... 69 5E-07 gi|326579935|gb|HM469413.1| Talaromyces radicus strain KUC167... 797 0E00 gi|326579935|gb|HM469413.1| Talaromyces radicus strain KUC167... 157 1E-33 gi|311235642|gb|HQ288049.1| Penicillium variabile strain NRRL... 797 0E00 gi|311235642|gb|HQ288049.1| Penicillium variabile strain NRRL... 92 4E-14 gi|171464364|gb|EU262660.1| Talaromyces radicus strain MET090... 797 0E00 gi|171464364|gb|EU262660.1| Talaromyces radicus strain MET090... 159 3E-34 gi|1594472747|gb|MK646059.1| Talaromyces radicus isolate JJGG... 793 0E00 gi|1594472747|gb|MK646059.1| Talaromyces radicus isolate JJGG... 144 7E-30 gi|725095816|gb|KF984795.1| Talaromyces variabilis strain DTO... 792 0E00 gi|725095816|gb|KF984795.1| Talaromyces variabilis strain DTO... 129 2E-25 gi|299767730|gb|GQ999322.1| Uncultured fungus clone LX042768-... 792 0E00 gi|299767730|gb|GQ999322.1| Uncultured fungus clone LX042768-... 159 3E-34 gi|299767727|gb|GQ999319.1| Uncultured fungus clone LX042768-... 792 0E00 gi|299767727|gb|GQ999319.1| Uncultured fungus clone LX042768-... 159 3E-34 gi|511783057|gb|KC466524.1| Talaromyces variabilis 18S riboso... 792 0E00 gi|511783057|gb|KC466524.1| Talaromyces variabilis 18S riboso... 153 1E-32 gi|321172822|gb|HQ698594.1| Penicillium variabile strain NRRL... 790 0E00 gi|321172822|gb|HQ698594.1| Penicillium variabile strain NRRL... 79 3E-10 gi|1628769687|gb|MK240332.1| Talaromyces variabilis strain Fe... 789 0E00 gi|1628769687|gb|MK240332.1| Talaromyces variabilis strain Fe... 59 2E-04 gi|1584169938|gb|MK577438.1| Penicillium sp. isolate QM-M sma... 789 0E00 gi|1584169938|gb|MK577438.1| Penicillium sp. isolate QM-M sma... 147 6E-31 gi|1270026405|gb|KY379802.1| Talaromyces sp. strain NT5-17 in... 789 0E00 gi|748806741|gb|KM279975.1| Talaromyces radicus isolate UASWS... 789 0E00 gi|748806741|gb|KM279975.1| Talaromyces radicus isolate UASWS... 57 9E-04 gi|1666020307|gb|MK183804.1| Talaromyces variabilis strain NQ... 784 0E00 gi|1666020307|gb|MK183804.1| Talaromyces variabilis strain NQ... 91 4E-14 gi|1628757350|gb|MH935987.1| Talaromyces sp. strain 6HVCE1 sm... 784 0E00 gi|1628757350|gb|MH935987.1| Talaromyces sp. strain 6HVCE1 sm... 159 3E-34 gi|1511001243|gb|MG957181.1| Talaromyces variabilis isolate 4... 782 0E00 gi|1511001243|gb|MG957181.1| Talaromyces variabilis isolate 4... 140 9E-29 gi|1511001243|gb|MG957181.1| Talaromyces variabilis isolate 4... 782 0E00 gi|1511001243|gb|MG957181.1| Talaromyces variabilis isolate 4... 140 9E-29 gi|1005417929|gb|KT958549.1| Talaromyces radicus strain DsppF... 782 0E00 gi|1005417929|gb|KT958549.1| Talaromyces radicus strain DsppF... 138 3E-28 gi|961554357|gb|KT264430.1| Talaromyces sp. isolate AM081-P10... 782 0E00 gi|961554357|gb|KT264430.1| Talaromyces sp. isolate AM081-P10... 159 3E-34 gi|536708330|gb|KF053672.1| Talaromyces radicus strain H9 int... 782 0E00 gi|498922946|gb|KC920846.1| Talaromyces radicus isolate CrP20... 782 0E00 gi|498922946|gb|KC920846.1| Talaromyces radicus isolate CrP20... 94 1E-14 gi|498922944|gb|KC920844.1| Talaromyces radicus isolate CrP18... 782 0E00 gi|498922944|gb|KC920844.1| Talaromyces radicus isolate CrP18... 65 6E-06 gi|498922943|gb|KC920843.1| Talaromyces radicus isolate CrP17... 782 0E00 gi|498922943|gb|KC920843.1| Talaromyces radicus isolate CrP17... 65 6E-06 gi|1347308147|gb|MG976292.1| Talaromyces wortmannii isolate 4... 779 0E00 gi|1347308147|gb|MG976292.1| Talaromyces wortmannii isolate 4... 76 3E-09 gi|1473252768|gb|MH865712.1| Talaromyces wortmannii strain CB... 779 0E00 gi|1473252768|gb|MH865712.1| Talaromyces wortmannii strain CB... 117 1E-21 gi|1473245354|gb|MH858298.1| Talaromyces wortmannii strain CB... 779 0E00 gi|1473245354|gb|MH858298.1| Talaromyces wortmannii strain CB... 146 2E-30 gi|1042744486|gb|KU839509.1| Fungal sp. strain S252D internal... 779 0E00 gi|1042744486|gb|KU839509.1| Fungal sp. strain S252D internal... 105 7E-18 gi|1042744118|gb|KU839141.1| Fungal sp. strain S195T internal... 779 0E00 gi|1042744118|gb|KU839141.1| Fungal sp. strain S195T internal... 127 2E-24 gi|1042744112|gb|KU839135.1| Fungal sp. strain S194T internal... 779 0E00 gi|1042744112|gb|KU839135.1| Fungal sp. strain S194T internal... 131 5E-26 gi|1042744111|gb|KU839134.1| Fungal sp. strain S194S internal... 779 0E00 gi|1042744111|gb|KU839134.1| Fungal sp. strain S194S internal... 130 2E-25 gi|1042744109|gb|KU839132.1| Fungal sp. strain S194N internal... 779 0E00 gi|1042744109|gb|KU839132.1| Fungal sp. strain S194N internal... 131 5E-26 92 gi|1042744104|gb|KU839127.1| Fungal sp. strain S194C internal... 779 0E00 gi|1042744104|gb|KU839127.1| Fungal sp. strain S194C internal... 101 8E-17 gi|1042744103|gb|KU839126.1| Fungal sp. strain S194B internal... 779 0E00 gi|1042744103|gb|KU839126.1| Fungal sp. strain S194B internal... 101 8E-17 gi|1042744102|gb|KU839125.1| Fungal sp. strain S194A internal... 779 0E00 gi|1042744102|gb|KU839125.1| Fungal sp. strain S194A internal... 101 8E-17 ALIGNMENTS >gb|MK841454.1| Penicillium concavorugulosum voucher NWUSeq42 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Length=570 Score = 796.6 bits (882), Expect = 0E00 Identities = 441/441 (100%), Gaps = 0/441 (0%) Strand = Plus/Minus Query 1 CCGCTTATTGATATGCTTAAGTTCAGCGGGTAGCCCTACCTGATCCGAGGTCAACCGGAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 565 CCGCTTATTGATATGCTTAAGTTCAGCGGGTAGCCCTACCTGATCCGAGGTCAACCGGAA 506 Query 61 GAGGCGCACCCCGAAGGGCGGCCTAAAGGGAAGACCAGCGCCGACCGAGTCCCTCCCGAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 505 GAGGCGCACCCCGAAGGGCGGCCTAAAGGGAAGACCAGCGCCGACCGAGTCCCTCCCGAG 446 Query 121 CGGGTGACAAAGCCCCATACGCTCGAGGACCCGACGCGGCGCCGCCACTGCTTTTGGGGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 445 CGGGTGACAAAGCCCCATACGCTCGAGGACCCGACGCGGCGCCGCCACTGCTTTTGGGGC 386 Query 181 GTGTCCCCGGGGGGACAGCGCCCAACACCCAGCCGTGCTGGAGGGCAGAAATGACGCTCG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 385 GTGTCCCCGGGGGGACAGCGCCCAACACCCAGCCGTGCTGGAGGGCAGAAATGACGCTCG 326 Query 241 GACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 325 GACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTC 266 Query 301 ACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 265 ACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGA 206 Query 361 ACCAAGAGATCCGTTGTTGAAAGTTTTAATGATTTCAAATCTCACTCAGACTCACTATTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 205 ACCAAGAGATCCGTTGTTGAAAGTTTTAATGATTTCAAATCTCACTCAGACTCACTATTC 146 Query 421 AGGCAGGGTTCTAGGGTGCGT 441 ||||||||||||||||||||| Sbjct 145 AGGCAGGGTTCTAGGGTGCGT 125 93 APPENDIX B: ANOVA TABLES FOR CHAPTER THREE ANOVA tables for Penicillium commune1 and F. oxysporum cultured together. Variate: P. commune1 Source of d.f. s.s. m.s. v.r. F.pr variation Day 4 17.9744 4.4936 5.41 0.004 Residual 20 16.6000 0.8300 Total 24 34.5744 Variate: F. oxysporum1 Source of variation d.f. s.s. m.s. v.r. F. pr Day 4 44.250 11.212 8.81 <.001 Residual 20 25.448 1.272 Total 24 70.298 ANOVA tables for Penicillium commune2 and F. oxysporum cultured together. Variate: P. commune2 Source of d.f. s.s. m.s. v.r. F. pr variation Day 4 0.5864 0.1466 0.58 0.678 Residual 20 5.0240 0.2512 Total 24 5.6104 94 Variate: F. oxysporum2 Source of d.f. s.s. m.s. v.r. F. pr variation Day 4 53.286 13.321 18.12 <.001 Residual 20 14.704 0.735 Total 24 67.989 ANOVA tables for Aspergillus fumigatus and F. oxysporum cultured together. Variate: A. fumigatus Source of d.f. s.s. m.s. v.r. F. pr variation Day 4 42.5144 10.6286 11.40 <0.001 Residual 20 18.6480 0.9324 Total 24 61.1624 Variate: F. oxysporum3 Source of d.f. s.s. m.s. v.r. F. pr variation Day 4 3.330 0.832 0.68 0.612 Residual 20 24.384 1.219 Total 24 27.714 95 ANOVA tables for Penicillium concavorugulosum1 and F. oxysporum cultured together. Variate: P. concavorugulosum1 Source of variation d.f. s.s. m.s. v.r. F. pr Day 4 10.2496 2.5324 4.13 0.013 Residual 20 12.4200 0.6210 Total 24 22.6696 Variate: F. oxysporum4 Source of d.f. s.s. m.s. v.r. F. pr variation Day 4 25.714 6.428 24.54 <.001 Residual 20 5.240 0.262 Total 24 30.954 ANOVA tables for Penicillium concavorugulosum2 and F. oxysporum cultured together. Variate: P. concavorugulosum2 Source of d.f. s.s. m.s. v.r. F. pr variation Day 4 39.7160 9.9290 17.14 <0.001 Residual 20 11.5840 0.5792 Total 24 51.3000 Variate: F. oxysporum5 Source of d.f. s.s. m.s. v.r. F. pr variation Day 4 4.746 1.186 0.26 0.901 Residual 20 91.856 4.593 Total 24 96.602 96 APPENDIX C: CHAPTER FIVE EXPERIMENT PICTURES Figure C.1: 25cm diameter pots containing sown S. lycopersicum seeds in different treatments. Figure C.2: Solanum lycopersicum seedlings 97 Figure C.3: Control seedling and T5 seedlings Figure C.4: T2 seedlings before and after termination 98